212 resultados para Intelligent Agents
Resumo:
BRCA1 is a tumour suppressor gene implicated in the predisposition to early onset breast and ovarian cancer. We have generated cell lines with inducible expression of BRCA1 to evaluate its role in mediating the cellular response to various chemotherapeutic drugs commonly used in the treatment of breast and ovarian cancer. Induction of BRCA1 in the presence of Taxol and Vincristine resulted in a dramatic increase in cell death; an effect that was preceded by an acute arrest at the G2/M phase of the cell cycle and which correlated with BRCA1 mediated induction of GADD45. A proportion of the arrested cells were blocked in mitosis suggesting activation of both a G2 and a mitotic spindle checkpoint. In contrast, no specific interaction was observed between BRCA1 induction and treatment of cells with a range of DNA damaging agents including Cisplatin and Adriamycin. Inducible expression of GADD45 in the presence of Taxol induced both G2 and mitotic arrest in these cells consistent with a role for GADD45 in contributing to these effects. Our results support a role for both BRCA1 and GADD45 in selectively regulating a G2/M checkpoint in response to antimicrotubule agents and raise the possibility that their expression levels in cells may contribute to the toxicity observed with these compounds.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
This paper presents a method for generating Pareto-optimal solutions in multi-party negotiations. In this iterative method, decision makers (DMs) formulate proposals that yield a minimum payoff to their opponents. Each proposal belongs to the efficient frontier, DMs try to adjust to a common one. In this setting, each DM is supposed to have a given bargaining power. More precisely each DM is supposed to have a subjective estimate of the power of the different parties. We study the convergence of the method, and provide examples where there is no possible agreement resulting from it.
Resumo:
This paper presents a novel approach based on the use of evolutionary agents for epipolar geometry estimation. In contrast to conventional nonlinear optimization methods, the proposed technique employs each agent to denote a minimal subset to compute the fundamental matrix, and considers the data set of correspondences as a 1D cellular environment, in which the agents inhabit and evolve. The agents execute some evolutionary behavior, and evolve autonomously in a vast solution space to reach the optimal (or near optima) result. Then three different techniques are proposed in order to improve the searching ability and computational efficiency of the original agents. Subset template enables agents to collaborate more efficiently with each other, and inherit accurate information from the whole agent set. Competitive evolutionary agent (CEA) and finite multiple evolutionary agent (FMEA) apply a better evolutionary strategy or decision rule, and focus on different aspects of the evolutionary process. Experimental results with both synthetic data and real images show that the proposed agent-based approaches perform better than other typical methods in terms of accuracy and speed, and are more robust to noise and outliers.