Hepatocyte growth factor (HGF) protects c-met-expressing Burkitt''s lymphoma cell lines from apoptotic death induced by DNA damaging agents

The relative sensitivity of neoplastic cells to DNA damaging agents is a key factor in cancer therapy. In this paper, we show that pretreatment of Burkitt's lymphoma cell lines expressing the c-met protooncogene with hepatocyte growth factor (HGF) protects them from death induced by DNA damaging agents commonly used in tumour therapy. This protection was observed in assays based on morphological assessment of apoptotic cells and DNA fragmentation assays. The protection was dose- and time-dependent — maximal protection requiring pre-incubation with 100 ng/ml HGF for 48 h. Western blotting analysis and flow cytometric studies revealed that HGF inhibited doxorubicin- and etoposide-induced decreases in the levels of the anti-apoptotic proteins Bcl-XL, and to a lesser extent Bcl-2, without inducing changes in the pro-apoptotic Bax protein. Overall, these studies suggest that the accumulation of HGF within the microenvironment of neoplastic cells may contribute to the development of a chemoresistant phenotype.

A novel, long-acting agonist of glucose-dependent insulinotropic polypeptide suitable for once-daily administration in type 2 diabetes

Glucose-dependent insulinotropic polypeptide (GIP) is a gastrointestinal hormone with a potentially therapeutic role in type 2 diabetes. Rapid degradation by dipeptidylpeptidase IV has prompted the development of enzyme-resistant N-terminally modified analogs, but renal clearance still limits in vivo bioactivity. In this study, we report long-term antidiabetic effects of a novel, N-terminally protected, fatty acid-derivatized analog of GIP, N-AcGIP(LysPAL(37)), in obese diabetic (ob/ob) mice. Once-daily injections of N-AcGIP(LysPAL(37)) over a 14-day period significantly decreased plasma glucose, glycated hemoglobin, and improved glucose tolerance compared with ob/ob mice treated with saline or native GIP. Plasma insulin and pancreatic insulin content were significantly increased by N-AcGIP(LysPAL(37)). This was accompanied by a significant enhancement in the insulin response to glucose together with a notable improvement of insulin sensitivity. No evidence was found for GIP receptor desensitization and the metabolic effects of NAcGIP(LysPAL(37)) were independent of any change in feeding or body weight. Similar daily injections of native GIP did not affect any of the parameters measured. These data demonstrate the ability of once-daily injections of N-terminally modified, fatty acid-derivatized analogs of GIP, such as N-AcGIP(LysPAL(37)), to improve diabetes control and to offer a new class of agents for the treatment of type 2 diabetes.

The area-independent effects of habitat complexity on biodiversity vary between regions.

Potential explanatory variables often co-vary in studies of species richness. Where topography varies within a survey it is difficult to separate area and habitat-diversity effects. Topographically complex surfaces may contain more species due to increased habitat diversity or as a result of increased area per se. Fractal geometry can be used to adjust species richness estimates to control for increases in area on complex surfaces. Application of fractal techniques to a survey of rocky shores demonstrated an unambiguous area-independent effect of topography on species richness in the Isle of Man. In contrast, variation in species richness in south-west England reflected surface availability alone. Multivariate tests and variation in limpet abundances also demonstrated regional variation in the area-independent effects of topography. Community composition did not vary with increasing surface complexity in south-west England. These results suggest large-scale gradients in the effects of heterogeneity on community processes or demography.

BRCA1 and GADD45 mediated G2/M cell cycle arrest in response to antimicrotubule agents

BRCA1 is a tumour suppressor gene implicated in the predisposition to early onset breast and ovarian cancer. We have generated cell lines with inducible expression of BRCA1 to evaluate its role in mediating the cellular response to various chemotherapeutic drugs commonly used in the treatment of breast and ovarian cancer. Induction of BRCA1 in the presence of Taxol and Vincristine resulted in a dramatic increase in cell death; an effect that was preceded by an acute arrest at the G2/M phase of the cell cycle and which correlated with BRCA1 mediated induction of GADD45. A proportion of the arrested cells were blocked in mitosis suggesting activation of both a G2 and a mitotic spindle checkpoint. In contrast, no specific interaction was observed between BRCA1 induction and treatment of cells with a range of DNA damaging agents including Cisplatin and Adriamycin. Inducible expression of GADD45 in the presence of Taxol induced both G2 and mitotic arrest in these cells consistent with a role for GADD45 in contributing to these effects. Our results support a role for both BRCA1 and GADD45 in selectively regulating a G2/M checkpoint in response to antimicrotubule agents and raise the possibility that their expression levels in cells may contribute to the toxicity observed with these compounds.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Cathepsin S expression: An independent prognostic factor in glioblastoma tumours - A pilot Study

Cysteine proteinases have been implicated in astrocytoma invasion. We recently demonstrated that cathepsin S (CatS) expression is up-regulated in astrocytomas and provided evidence for a potential role in astrocytoma invasion (Flannery et al., Am J Path 2003;163(1):175–82). We aimed to evaluate the significance of CatS in human astrocytoma progression and as a prognostic marker. Frozen tissue homogenates from 71 patients with astrocytomas and 3 normal brain specimens were subjected to ELISA analyses. Immunohistochemical analysis of CatS expression was performed on 126 paraffin-embedded tumour samples. Fifty-one astrocytoma cases were suitable for both frozen tissue and paraffin tissue analysis. ELISA revealed minimal expression of CatS in normal brain homogenates. CatS expression was increased in grade IV tumours whereas astrocytoma grades I–III exhibited lower values. Immunohistochemical analysis revealed a similar pattern of expression. Moreover, high-CatS immunohistochemical scores in glioblastomas were associated with significantly shorter survival (10 vs. 5 months, p = 0.014). With forced inclusion of patient age, radiation dose and Karnofsky score in the Cox multivariate model, CatS score was found to be an independent predictor of survival. CatS expression in astrocytomas is associated with tumour progression and poor outcome in glioblastomas. CatS may serve as a useful prognostic indicator and potential target for anti-invasive therapy.