Within-host evolution of Burkholderia pseudomallei over a twelve-year chronic carriage infection

UNLABELLED: Burkholderia pseudomallei causes the potentially fatal disease melioidosis. It is generally accepted that B. pseudomallei is a noncommensal bacterium and that any culture-positive clinical specimen denotes disease requiring treatment. Over a 23-year study of melioidosis cases in Darwin, Australia, just one patient from 707 survivors has developed persistent asymptomatic B. pseudomallei carriage. To better understand the mechanisms behind this unique scenario, we performed whole-genome analysis of two strains isolated 139 months apart. During this period, B. pseudomallei underwent several adaptive changes. Of 23 point mutations, 78% were nonsynonymous and 43% were predicted to be deleterious to gene function, demonstrating a strong propensity for positive selection. Notably, a nonsense mutation inactivated the universal stress response sigma factor RpoS, with pleiotropic implications. The genome underwent substantial reduction, with four deletions in chromosome 2 resulting in the loss of 221 genes. The deleted loci included genes involved in secondary metabolism, environmental survival, and pathogenesis. Of 14 indels, 11 occurred in coding regions and 9 resulted in frameshift mutations that dramatically affected predicted gene products. Disproportionately, four indels affected lipopolysaccharide biosynthesis and modification. Finally, we identified a frameshift mutation in both P314 isolates within wcbR, an important component of the capsular polysaccharide I locus, suggesting virulence attenuation early in infection. Our study illustrates a unique clinical case that contrasts a high-consequence infectious agent with a long-term commensal infection and provides further insights into bacterial evolution within the human host.

IMPORTANCE: Some bacterial pathogens establish long-term infections that are difficult or impossible to eradicate with current treatments. Rapid advances in genome sequencing technologies provide a powerful tool for understanding bacterial persistence within the human host. Burkholderia pseudomallei is considered a highly pathogenic bacterium because infection is commonly fatal. Here, we document within-host evolution of B. pseudomallei in a unique case of human infection with ongoing chronic carriage. Genomic comparison of isolates obtained 139 months (11.5 years) apart showed a strong signal of adaptation within the human host, including inactivation of virulence and immunogenic factors, and deletion of pathways involved in environmental survival. Two global regulatory genes were mutated in the 139-month isolate, indicating extensive regulatory changes favoring bacterial persistence. Our study provides insights into B. pseudomallei pathogenesis and, more broadly, identifies parallel evolutionary mechanisms that underlie chronic persistence of all bacterial pathogens.

Putting chromatin immunoprecipitation into context

Chromatin immunoprecipitation (ChIP), when paired with sequencing or arrays, has become a method of choice for the unbiased identification of genomic-binding sites for transcription factors and epigenetic marks in various model systems. The data generated is often then interpreted by groups seeking to link these binding sites to the expression of adjacent or distal genes, and more broadly to the evolution of species, cell fate/differentiation or even cancer development. Against this backdrop is an ongoing debate over the relative importance DNA sequence versus chromatin structure and modification in the regulation of gene expression (Anon. 2008a Nature 454: 795; Anon. 2008b Nature 454: 711-715; Henikoff et al. 2008 Science 322: 853; Madhani et al. 2008 Science 322: 43-44). Rationally there is a synergy between the two and the goal of a biologist is to characterise both comprehensively enough to explain a cellular phenotype or a developmental process. If this is truly our goal then the critical factor in good science is an awareness of the constraints and potential of the biological models used. The reality however is often that this discussion is polarised by funding imperatives and the need to align to a transcription factor or epigenetic camp. This article will discuss the extrapolations involved in using ChIP data to draw conclusions about these themes and the discoveries that have resulted.

Identification of novel Factor XI mutations in a patient requiring dental extractions

Factor XI is a serine protease that participates in the intrinsic pathway of blood coagulation. Patients deficient in factor XI exhibit varying degrees of post operative bleeding following invasive surgical procedures such as dental extractions. Objectives: The aim of the study was to identify the specific mutations in a patient from a family with known factor XI deficiency. Methods: Samples were obtained from the patient, his mother and his father and subjected to DNA sequencing. Each protein coding exon 2-15 of the factor XI gene was amplified by polymerase chain reaction (PCR) followed by bidirectional sequencing utilizing di-deoxy chain termination chemistry. Results: The patient had a factor XI level of 20% of normal. Initial sequencing of factor XI from the patient identified a point mutation (646G>A) and a putative splice site mutation (1567+4A>T) in intron 13. These are novel previously unreported mutations. DNA sequence analysis of the mother revealed the 1567+4A>T mutation and the father exhibited the 646G>A mutation. As a consequence the treatment proceeded without serious bleeding complication and required administration only of transexamic acid though factor XI was available as haemostatic cover. Conclusion: The two mutations identified in this family are novel; further laboratory investigation of the functional consequences of those mutations is currently underway. Although factor XI deficiency is rare in the Northern Irish population this study highlights the techniques available to sequence and analyse this and similar haematological disorders.

DNA-dependent Protein Kinase-mediated Phosphorylation of Protein Kinase B Requires a Specific Recognition Sequence in the C-terminal Hydrophobic Motif

DNA-dependent protein kinase (DNA-PK) has been implicated in a variety of nuclear processes including DNA double strand break repair, V(D)J recombination, and transcription. A recent study showed that DNA-PK is responsible for Ser-473 phosphorylation in the hydrophobic motif of protein kinase B (PKB/Akt) in genotoxic-stressed cells, suggesting a novel role for DNA-PK in cell signaling. Here, we report that DNA-PK activity toward PKB peptides is impaired in DNA-PK knock-out mouse embryonic fibroblast cells when compared with wild type. In addition, human glioblastoma cells expressing a mutant form of DNA-PK (M059J) displayed a lower DNA-PK activity when compared with glioblastoma cells expressing wild-type DNA- PK (M059K) when PKB peptide substrates were tested. DNA- PK preferentially phosphorylated PKB on Ser-473 when compared with its known in vitro substrate, p53. A consensus hydrophobic amino acid surrounding the Ser-473 phospho-acceptor site in PKB containing amino acids Phe at position +1 and +4 and Tyr at position -1 are critical for DNA- PK activity. Thus, these data define the specificity of DNA- PK action as a Ser-473 kinase for PKB in DNA repair signaling.

Sequence-Specific and Strand-Specific Cleavage In Oligodeoxyribonucleotides and DNA Containing 3'-Thiothymidine

Oligonucleotides containing a 3'-thiothymidine residue (T3's) at the cleavage site for the EcoRV restriction endonuclease (between the central T and A residues of the sequence GATATC) have been prepared on an automated DNA synthesizer using 5'-O-monomethoxytritylthymidine 3'-S-(2-cyanoethyl N,N-di-isopropylphosphorothioamidite). The self-complementary sequence GACGAT3'sATCGTC was completely resistant to cleavage by EcoRV, while the heteroduplex composed of 5'-TCTGAT3'sATCCTC and 5'-GAGGATATCAGA (duplex 4) was cleaved only in the unmodified strand (5'-GAGGATATCAGA). In contrast, strands containing a 3'-S-phosphorothiolate linkage could be chemically cleaved specifically at this site with Ag+. A T3's residue has also been incorporated in the (-) strand of double-stranded closed circular (RF IV) M13mp18 DNA at the cleavage site of a unique EcoRV recognition sequence by using 5'-pCGAGCTCGAT3'sATCGTAAT as a primer for polymerization on the template (+) strand of M13mp18 DNA. On treatment of this substrate with EcoRV, only one strand was cleaved to produce the RF II or nicked DNA. Taken in conjunction with the cleavage studies on the oligonucleotides, this result demonstrates that the 3'-S-phosphorothiolate linkage is resistant to scission by EcoRV. Additionally, the phosphorothiolate-containing strand of the M13mp18 DNA could be cleaved specifically at the point of modification using iodine in aqueous pyridine. The combination of enzymatic and chemical techniques provides, for the first time, a demonstrated method for the sequence-specific cleavage of either the (+) or (-) strand.

Detection of single nucleotide polymorphisms within a sequence of a gene associated with prostate cancer using a fluorophore-tagged DNA probe

Single nucleotide polymorphisms within a sequence of a gene associated with prostate cancer were identified using oligodeoxynucleotide probe sequences bearing internal anthracene fluorophores proximal to the SNP site. Depending upon the nature of the synthesised target sequences, probe-target duplex formation could lead to enhanced or attenuated fluorescence emission from the anthracene, enabling detection of a proximal base-pair as either matching or mismatching. © 2011 Elsevier Ltd. All rights reserved.

New anti-HIV aptamers based on tetra-end-linked DNA G-quadruplexes: effect of the base sequence on anti-HIV activity.

This communication reports on the synthesis and biophysical, biological and SAR studies of a small library of new anti-HIV aptamers based on the tetra-end-linked G-quadruplex structure. The new aptamers showed EC(50) values against HIV-1 in the range of 0.04-0.15 µM as well as affinities for the HIV-1 gp120 envelope in the same order of magnitude

Synthesis of N3- and 2-NH2-substituted 6,7-diphenylpterins and their use as intermediates for the preparation of oligonucleotide conjugates designed to target photooxidative damage on single-stranded DNA representing the bcr-abl chimeric gene

Two 17-mer oligodeoxynucleotide-5'-linked-(6,7-diphenylpterin) conjugates, 2 and 3, were prepared as photosensitisers for targeting photooxidative damage to a 34-mer DNA oligodeoxynucleotide (ODN) fragment 1 representing the chimeric bcr-abl gene that is implicated in the pathogenesis of chronic myeloid leukaemia (CML). The base sequence in the 17-mer was 3'G G T A G T T A T T C C T T C T T5'. In the first of these ODN conjugates (2) the pterin was attached at its N3 atom, via a -(CH2)3OPO(OH)- linker, to the 5'-OH group of the ODN. Conjugate 2 was prepared from 2-amino-3-(3-hydroxypropyl)-6,7-diphenyl-4(3H)-pteridinone 10, using phosphoramidite methodology. Starting material 10 was prepared from 5-amino-7-methylthiofurazano[3,4-d]pyrimidine 4 via an unusual highly resonance stabilised cation 8, incorporating the rare 2H,6H-pyrimido[6,1-b][1,3]oxazine ring system. In the characterisation of 10 two pteridine phosphazenes, 15 and 29, were obtained, as well as new products containing two uncommon tricyclic ring systems, namely pyrimido[2,1-b]pteridine (20 and 24) and pyrimido[1,2-c]pteridine (27). In the second ODN conjugate the linker was -(CH2)5CONH(CH2)6OPO(OH)- and was attached to the 2-amino group of the pterin. In the preparation of 3, the N-hydroxysuccinimide ester 37 of 2-(5-carboxypentylamino)-6,7-diphenyl-4(3H)-pteridinone was condensed with the hexylamino-modified 17-mer. Excitation of 36 with near UV light in the presence of the single-stranded target 34-mer, 5'T G A C C A T C A A T A A G14 G A A G18 A A G21 C C C T T C A G C G G C C3' 1 caused oxidative damage at guanine bases, leading to alkali-labile sites which were monitored by polyacrylamide gel electrophoresis. Cleavage was observed at all guanine sites with a marked preference for cleavage at G14. In contrast, excitation of ODN-pteridine conjugate 2 in the presence of 1 caused oxidation of the latter predominantly at G18, with a smaller extent of cleavage at G15 and G14 (in the double-stranded portion) and G21. These results contrast with our previous observation of specific cleavage at G21 with ruthenium polypyridyl sensitisers, and suggest that a different mechanism, probably one involving Type 1 photochemical electron transfer, is operative. Much lower yields were found with the ODN-pteridine conjugate 3, perhaps as a consequence of the longer linker between the ODN and the pteridine in this case.

Metastasis-inducing DNA Regulates the Expression of the Osteopontin Gene by Binding the Transcription Factor Tcf-4

Small 1,000-bp fragments of genomic DNA obtained from human malignant breast cancer cell lines when transfected into a benign rat mammary cell line enhance transcription of the osteopontin gene and thereby cause the cells to metastasize in syngeneic rats. To identify the molecular events underlying this process, transient cotransfections of an osteopontin promoter-reporter construct and fragments of one metastasis-inducing DNA (Met-DNA) have identified the active components in the Met-DNA as the binding sites for the T-cell factor (Tcf) family of transcription factors. Incubation of cell extracts with active DNA fragments containing the sequence CAAAG caused retardation of their mobilities on polyacrylamide gels, and Western blotting identified Tcf-4, beta-catenin, and E-cadherin in the relevant DNA complexes in vitro. Transfection of an expression vector for Tcf-4 inhibited the stimulated activity of the osteopontin promoter-reporter construct caused by transiently transfected active fragments of Met-DNA or permanently transfected Met-DNA. This stimulated activity of the osteopontin promoter-reporter construct is accompanied by an increase in endogenous osteopontin mRNA but not in fos or actin mRNAs in the transfected cells. Permanent transfection of the benign rat mammary cell line with a 20-bp fragment from the Met-DNA containing the Tcf recognition sequence CAAAG caused an enhanced permanent production of endogenous osteopontin protein in vitro and induced the cells to metastasize in syngeneic rats in vivo. The corresponding fragment without the CAAAG sequence was without either effect. Therefore, the regulatory effect of the C9-Met-DNA is exerted, at least in part, by a CAAAG sequence that can sequester the endogenous inhibitory Tcf-4 and thereby promote transcription of osteopontin, the direct effector of metastasis in this system.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.