194 resultados para Col·laborative agents
Resumo:
BRCA1 is a tumour suppressor gene implicated in the predisposition to early onset breast and ovarian cancer. We have generated cell lines with inducible expression of BRCA1 to evaluate its role in mediating the cellular response to various chemotherapeutic drugs commonly used in the treatment of breast and ovarian cancer. Induction of BRCA1 in the presence of Taxol and Vincristine resulted in a dramatic increase in cell death; an effect that was preceded by an acute arrest at the G2/M phase of the cell cycle and which correlated with BRCA1 mediated induction of GADD45. A proportion of the arrested cells were blocked in mitosis suggesting activation of both a G2 and a mitotic spindle checkpoint. In contrast, no specific interaction was observed between BRCA1 induction and treatment of cells with a range of DNA damaging agents including Cisplatin and Adriamycin. Inducible expression of GADD45 in the presence of Taxol induced both G2 and mitotic arrest in these cells consistent with a role for GADD45 in contributing to these effects. Our results support a role for both BRCA1 and GADD45 in selectively regulating a G2/M checkpoint in response to antimicrotubule agents and raise the possibility that their expression levels in cells may contribute to the toxicity observed with these compounds.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
This paper presents a method for generating Pareto-optimal solutions in multi-party negotiations. In this iterative method, decision makers (DMs) formulate proposals that yield a minimum payoff to their opponents. Each proposal belongs to the efficient frontier, DMs try to adjust to a common one. In this setting, each DM is supposed to have a given bargaining power. More precisely each DM is supposed to have a subjective estimate of the power of the different parties. We study the convergence of the method, and provide examples where there is no possible agreement resulting from it.
Resumo:
The purpose of this paper is to expose the concept of collaborative planning to the reality of planning, thereby assessing its efficacy for informing and explaining what planners 'really' do and can do. In this systematic appraisal, collaborative planning is disaggregated into four elements that can enlighten such conceptual frameworks: ontology, epistemology, ideology and methodology. These four lenses help delimit and clarify collaborative planning's strengths and weaknesses. The conceptual debate is related to an empirical investigation of planning processes, ranging from region-wide to local and from statutory to visionary in an arena where special care has been invested in participatory deliberation processes. The final analysis provides a systematic gauge of collaborative planning in light of the extensive empirical evidence, deploying the four conceptual dimensions introduced in part one. This exposes a range of problems not only with the concept itself but also regarding its affinity with the uncollaborative world within which it has to operate. The former shed light on those aspects where collaborative planning as a conceptual tool for practitioners needs to be renovated, while the latter highlight inconsistencies in a political framework that struggles to accommodate both global competitiveness and local democratic collaboration.
Resumo:
Cerebral palsy (CP) is a relatively rare condition with enormous social and financial impact. Information about CP is not routinely collected in the United Kingdom. We have pooled non-identifiable data from the five currently active UK CP registers to form the UKCP database: birth years 1960–1997. This article describes the rationale behind this collaboration and the creation of the database. Data about 6910 children with CP are currently held. The mean annual prevalence rate was 2.0 per 1000 live births for birth years 1986–1996. Where type is known, 91 per cent have spastic CP. Where data are available, nearly one-third of children have severely impaired lower limb function, and nearly a quarter have severely impaired upper limb function. As well as describing the range and complexity of motor and associated impairments, the pooled data from the UKCP database provide a platform for studies of aetiology, long-term outcomes, participation and service needs. The UKCP database is an important national resource for the surveillance of CP and the study of its epidemiology in the United Kingdom.