46 resultados para BIS(OXAZOLINE)-COPPER COMPLEXES
Resumo:
A new class of platinum-bipyridyl compounds has been synthesized by the dehydrohalogenative reaction of [4,4'-bis(tert-butyl)-2,2'-bipyridyl]platinum dichloride [PtCl2((t)Bu(2)bipy)] 1 with terminal alkynes HC=CR, in the presence of copper(I) iodide and diisopropylamine. The products [Pt(C=CR)(2)((t)Bu(2)bipy)] (R=C6H4NO2-p 2, C6H5 3, C6H4CH3-p 4 or SiMe3 5), have been characterised by spectroscopic and analytical methods, and a single crystal molecular structure determination has been carried out on 4. Extended Huckel molecular orbital calculations have also been carried out, and the results are used to help rationalise the voltammetric, EPR and spectroelectrochemical properties of the new compounds. These show that compounds 3, 4 and 5 undergo a one-electron bipyridyl based redox process, but that 2 has an unresolved two-electron process located on the nitro groups.
Resumo:
[Pt(Me(2)bipy)Cl-2](Me(2)bipy = 4,4'-dimethyl-2,2'-bipyridine) and HC=CC6H4-4-R react in the presence of diisopropylamine and CuI as catalyst to give the platinum bis-acetylides [Pt(Me(2)bipy)(C=CC6H4-4-R)(2)] R = H, Me, NO2. Initial spectroscopic, electrochemical and reactivity studies are presented. (C) 1997 Elsevier Science S.A.
ABSORPTION-SPECTRA AND DYNAMICS OF CHARGE-TRANSFER EXCITED-STATES OF COPPER(I) COMPLEXES IN SOLUTION
Resumo:
Two novel alkynyl-bridged symmetric bis-tridentate ligands 1,2-bis(1'-[4'-(2,2':6', 2 ''-terpyridinyl)]-ferrocenyl)ethyne (3a; tpy-Fc-C C-Fc-tpy; Fc = ferrocenyl; tpy = terpyridyl) and 1,4-bis(1'-[4'-(2,2':6', 2 ''-terpyridinyl)]ferrocenyl)-1,3-butadiyne (3b; tpy-Fc-C C-C C-Fc-tpy) and their Ru2+ complexes 6a and 6b have been synthesized and characterized by cyclic voltammetry, UV-vis and luminescence spectroscopy, and in the case of 3b by single-crystal X-ray diffraction. Cyclic voltammograms of both compounds, 3a and 3b, display two severely overlapping ferrocene-based oxidative peaks with only one reductive peak. The redox behavior of 6a and 6b is dominated by the Ru2+/Ru3+ redox couple (E-1/2 from 1.33 to 1.34 V), the Fe2+/Fe3+ redox couples (E-1/2 from 0.46 to 0.80 V), and the tpy/tpy(-)/tpy(2-)redox couples (E-1/2 from -1.19 to -1.48 V). The UV-vis spectra of 6a and 6b show absorption bands assigned to the (1)[(d(pi)(Fe))(6)] -> (1)[(d(pi)(Fe))(5)(pi*(Ru)(tpy))(1)] MMLCT transition at similar to 555 nm. Complexes 6a and 6b are luminescent in H2O-CH3CN (4 : 1, v/v) solution at room temperature, and 6b exhibits the strongest luminescence intensity (lambda(em)(max): 710 nm, Phi(em): 2.28 x 10(-4), tau: 358 ns) relative to analogous ferrocene-based bis(terpyridine) Ru(II) complexes reported so far.
Resumo:
The structural and coordination properties of complexes formed upon the interaction of copper(II) and chromium(II) chlorides with diallrylimidazolium chloride (RMlm(+)Cl(-)) ionic liquids and glucose are studied by a combination of density functional theory (DFT) calculations and X-ray absorption spectroscopy (XAS). In the absence of the carbohydrate substrate, isolated mononuclear four-coordinated MeCl42- species (Me = Cu, Cr) dominate in the ionic liquid solution. The organic part of the ionic liquid does not directly interact with the metal centers. The interactions between the RMlm(+) cations and the anionic metal chloride complexes are limited to hydrogen bonding with the basic Cl- ligands and the overall electrostatic stabilization of the anionic metal complexes. Exchange of Cl ligands by a hydroxyl group of glucose is only favorable for CrCl42-. For Cu2+ complexes, the formation of hydrogen bonded complexes between CuCl42- and glucose is preferred. No preference for the coordination of metal chloride species to specific hydroxyl group of the carbohydrate is found. The formation of binuclear metal chloride complexes is also considered. The reactivity and selectivity patterns of the Lewis acid catalyzed reactions of glucose are discussed in the framework of the obtained results.
Resumo:
The effects of diphosphine flexibility and bite angle on the structures and luminescence properties of Au(I) complexes have been investigated. A range of diphosphines based on heteroaromatic backbones [bis(2-diphenylphosphino)phenylether (dpephos), 9,9-dimethyl-4,5-bis(diphenylphosphino)xanthene (xantphos), and 4,6-bis(diphenylphosphino)dibenzofuran (dbfphos)] has been used to prepare mono- and digold derivatives. A clear relationship between the presence of aurophilic contacts and the emission properties of dinuclear complexes has been observed, with one of the complexes studied, [Au(2)Cl(2)(micro-xantphos)], exhibiting luminescence thermochromism.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.
Resumo:
A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.
Resumo:
Enantiomerically pure N,N'-bis(-2,2'-dipyridyl-5-yl)carbonyl-(S/R,S/R)-1,2-diphenylethylenediamine has been synthesised by linking two 2,2'-bipyridine units by (R,R)- and (S,S)-1,2-diphenylethylenediamine. The ligands possess a hindered rotation between the bipyridine chromophores, which are held together by intramolecular hydrogen bonds. ES mass spectroscopy confirmed that reaction with Fe(II), Co(III) and Cd(II) afforded dinuclear complexes. CD spectroscopy implied that enantiopure ligands conferred helicity to the metals centre giving a dominant triple helicate diastereoisomer (with the RR isomer giving a P helicate). H-1 NMR spectroscopy of the cadmium complex confirmed the presence of a single diastereoisomer. (C) 2003 Elsevier B.V. All rights reserved.
Resumo:
The enantiomerically pure ligand L-3RR (2R, 3R)-bis(2,2'-dipyridyl-5-methoxyl) butane has been synthesised by linking two 2,2'-bipyridine units with (2R, 3R)-butandiol. The reaction of L-3RR with Zn(II) afforded a mononuclear species and the H-1 NMR spectroscopy points to a C-1 symmetry, expected for a distorted trigonal bipyramidal coordination environment. These observations were confirmed by MM2 calculations and electrospray mass spectrometry. The reaction of L-3RR with iron(II) indicated the formation of a dinuclear species by mass spectrometry. Solution state CD spectroscopy indicates that both complexes adopt a Lambda-configuration, implying a single stranded dinuclear iron(II) complex is present rather than the anticipated triple helical architecture.
Resumo:
The task-specific ionic liquid betainium bis(trifluoromethylsulfonyl)imide, [Hbet][Tf2N], was used to dissolve metal oxides and hydroxides. The crystal structures of the resulting metal betaine bistriflimide complexes exhibit a rich structural variety. A trimeric structure was found for the cobalt(II) compound, [Co-3(bet)(8)(Hbet)(2)(H2O)(2)][Tf2N](9)[Hbet], a tetrameric structure for the manganese(II) and zinc(II) compound, [Mn-4(bet)(10)(H2O)(4)][Tf2N](8) and [Zn-4(bet)(10)(H2O)(2)][Tf2N](8), respectively, a pentameric structure for the nickel(II) compound, [Ni-5(bet)(12)(H2O)(6)][Tf2N](10), an oxo-hydroxo-cluster formation for the lead(II) compound, [(Pb4O)Pb(OH)(bet)(8)(Tf2N)3] [Tf2N](4)center dot MeOH, and a polymeric structure for the silver(I) compound, [Ag-2(bet)(2)(Tf2N)Ag-2(bet)(2)][Tf2N](3). The zwitterionic nature of the betaine ligand and the weakly coordinating ability of the bis(trifluoromethylsulfonyl)imide [Tf2N]- anion facilitates the incorporation of metal ions into oligonuclear and polynuclear metal complexes.
Resumo:
The dissolution process of metal complexes in ionic liquids was investigated by a multiple-technique approach to reveal the solvate species of the metal in solution. The task-specific ionic liquid betainium bis(trifluoromethylsulfonyl)imide ([Hbet][Tf2N]) is able to dissolve stoichiometric amounts of the oxides of the rare-earth elements. The crystal structures of the compounds [Eu-2(bet)(8)(H2O)(4)][Tf2N](6), [Eu-2(bet)(8)(H2O)(2)][Tf2N](6)center dot 2H(2)O, and [Y-2(bet)(6)(H2O)(4)][Tf2N](6) were found to consist of dimers. These rare-earth complexes are well soluble in the ionic liquids [Hbet][Tf2N] and [C(4)mim]- [Tf2N] (C(4)mim = 1-butyl-3-methylimidazolium). The speciation of the metal complexes after dissolution in these ionic liquids was investigated by luminescence spectroscopy, H-1, C-13, and Y-89 NMR spectroscopy, and by the synchrotron techniques EXAFS (extended X-ray absorption fine structure) and HEXS (high-energy X-ray scattering). The combination of these complementary analytical techniques reveals that the cationic dimers decompose into monomers after dissolution of the complexes in the ionic liquids. Deeper insight into the solution processes of metal compounds is desirable for applications of ionic liquids in the field of electrochemistry, catalysis, and materials chemistry.