139 resultados para Ruthenium compounds


Relevância:

30.00% 30.00%

Publicador:

Resumo:

In chloroform, [RuCl2(nbd)(py)(2)] (1) (nbd = norbornadiene; py = pyridine) reacts with 1,4-bis(diphenylphosphino)-1,2,3,4-tetramethyl-1,3-butadiene (1,2,3,4-Me-4-NUPHOS) to give the dimer [Ru2Cl3(eta(4)-1,2,3,4-Me-4-NUPHOS)(2)]Cl (2a), whereas, in THF [RuCl2(1,2,3,4-Me-4-NUPHOS)(PY)(2)] (3) is isolated as the sole product of reaction. Compound 2 exists as a 4:1 mixture of two noninterconverting isomers, the major with C, symmetry and the minor with either C, or C-2 symmetry. A single-crystal X-ray analysis of [Ru2Cl3 (eta(4)-1,2,3,4-Me-4-NUPHOS)(2)] [SbF6] (2b), the hexafluoroantimonate salt of 2a, revealed that the diphosphine coordinates in an unusual manner, as a eta(4)-six-electron donor, bonded through both P atoms and one of the double bonds of the butadiene tether. Compounds 2a and 3 react with 1,2-ethylenediamine (en) in THF to afford [RuCl2(1,2,3,4-Me-4-NUPHOS)(en)] (4), which rapidly dissociates a chloride ligand in chloroform to give [RuCl(eta(4)-1,2,3,4-Me-4-NUPHOS)(en)] [Cl] (5a). Complexes 4 and 5a cleanly and quantitatively interconvert in a solvent-dependent equilibrium, and in THF 5a readily adds chloride to displace the eta(2)-interaction and re-form 4. A single-crystal X-ray structure determination of [RuCl(eta(4)-1,2,3,4-Me-4-NUPHOS)(en)][ClO4] (5b) confirmed that the diphosphine coordinates in an eta(4)-manner as a facial six-electron donor with the eta(2)-coordinated double bond occupying the site trans to chloride. The eta(4)-bonding mode can be readily identified by the unusually high-field chemical shift associated with the phosphorus atom adjacent to the eta(2)-coordinated double bond. Complexes 2a, 2b, 4, and 5a form catalysts that are active for transfer hydrogenation of a range of ketones. In all cases, catalysts formed from precursors 2a and 2b are markedly more active than those formed from 4 and 5a.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In this study, we describe, for the first time, the synthesis and photophysical and microbiological investigation of ruthenium trischelate diimine complexes designed so as to possess properties specifically suited for use in Photodynamic antimicrobial chemotherapy (PACT). Of the three compounds investigated, one ([Ru(dmob)(3)]Cl-2) has demonstrated considerable promise as a photosensitiser for use in PACT. As a result, this compound is now the subject of comprehensive chemical, toxicological and formulation studies.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The new anionic functionalized aryldiamine ligands [2,6-(Me(2)NCH(2))(2)-4-R-C6H2](-) (R = Me(3)SiC=C, C6H5, Me(3)Si), formally derived from [2,6-(Me(2)NCH(2))(2)C6H3](-), have been prepared as their lithium compounds. The compound [Li{2,6-(Me(2)NCH(2))(2)-4-Ph-C6H2}](2) crystallizes in the monoclinic space group C2/c (no. 15) with a = 13.1225(5), b = 13.5844(7), c = 15.9859(12) Angstrom, beta = 105.329(5)degrees, V = 3264.0(3)Angstrom(3), Z = 4. The structure refinement converged to R(1) = 0.0374 for 2037 observed reflections [F-o>4 sigma(F-o)] and wR(2) = 0.0922 for 2560 unique data. The organolithium compounds have been used in transmetalation reactions to give the corresponding functionalized organoruthenium(II) complexes [Ru-II{2,6-(Me(2)NCH(2))(2)-4-R-C6H2}(terpy)]Cl-+(-) (terpy = 2,2';6',2 ''-terpyridine). The Ru-II species with R = HC = C has also been synthesized.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Symmetrical and unsymmetrical ligands containing terpyridyl coordinating units (N, N, N) or a cyclometalating equivalent (N, C, N), connected back-to-back either directly or via a p-terphenylene or 1,3-phenylene spacer, have been used to construct new diruthenium complexes. These compounds incorporate various terdentate chelates as capping ligands, to allow a double control of the electronic properties of each subcomplex and of the ensemble: via the terminal ligand or through the bridging fragment. Electronic coupling was studied from the intervalence transitions observed in several bimetallic ruthenium complexes of the bis-(cyclometalated) type differing by the substitution of a nitrogen atom by carbon in the terminal terpyridyl unit. The largest metal-metal interaction was found in complexes for which the terminal complexing unit is of the 1,3-di-2-pyridylbenzene type, i.e., with the carbon atom located on the metal-metal C-2 axis of the molecule. Investigations of the mechanism of interaction by extended Huckel calculations showed that the replacement of nitrogen by carbon raises the filled ligand levels, increasing the mixing with ligand orbitals and thus the metal-metal coupling. Finally, the intervalence transition was still observed for a bridging ligand containing three phenylene units as spacers, corresponding to a 24-Angstrom metal-metal distance.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Two novel alkynyl-bridged symmetric bis-tridentate ligands 1,2-bis(1'-[4'-(2,2':6', 2 ''-terpyridinyl)]-ferrocenyl)ethyne (3a; tpy-Fc-C C-Fc-tpy; Fc = ferrocenyl; tpy = terpyridyl) and 1,4-bis(1'-[4'-(2,2':6', 2 ''-terpyridinyl)]ferrocenyl)-1,3-butadiyne (3b; tpy-Fc-C C-C C-Fc-tpy) and their Ru2+ complexes 6a and 6b have been synthesized and characterized by cyclic voltammetry, UV-vis and luminescence spectroscopy, and in the case of 3b by single-crystal X-ray diffraction. Cyclic voltammograms of both compounds, 3a and 3b, display two severely overlapping ferrocene-based oxidative peaks with only one reductive peak. The redox behavior of 6a and 6b is dominated by the Ru2+/Ru3+ redox couple (E-1/2 from 1.33 to 1.34 V), the Fe2+/Fe3+ redox couples (E-1/2 from 0.46 to 0.80 V), and the tpy/tpy(-)/tpy(2-)redox couples (E-1/2 from -1.19 to -1.48 V). The UV-vis spectra of 6a and 6b show absorption bands assigned to the (1)[(d(pi)(Fe))(6)] -> (1)[(d(pi)(Fe))(5)(pi*(Ru)(tpy))(1)] MMLCT transition at similar to 555 nm. Complexes 6a and 6b are luminescent in H2O-CH3CN (4 : 1, v/v) solution at room temperature, and 6b exhibits the strongest luminescence intensity (lambda(em)(max): 710 nm, Phi(em): 2.28 x 10(-4), tau: 358 ns) relative to analogous ferrocene-based bis(terpyridine) Ru(II) complexes reported so far.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The synthesis of a number of new 2,2'-bipyridine ligands, functionalized with bulky ester side groups is reported (L2 - L8). Their reaction with [Ru(DMSO)4Cl2] gives rise to tris-chelate ruthenium(II) metal complexes which show an unusually high proportion of the fac-isomer, as judged by 1H NMR following conversion to the ruthenium(II) complex of 2,2'-bipyridine-5-carboxylic acid methyl ester (L1). The initial reaction appears to have thermodynamic control with the steric bulk of the ligands causing the third ligand to be labile under the reaction conditions used, giving rise to disappointing yields and allowing rearrangement to the more stable facial form. DFT studies indicate that this does not appear to be as a consequence of a metal centered electronic effect. The two isomers of [Ru(L1)3](PF6)2 were separated into the two individual forms using silica preparative plate chromatographic procedures, and the photophysical characteristics of the two forms compared. The results appear to indicate that there is no significant difference in both their room temperature electronic absorption and emission spectra or their excited state lifetimes at 77K.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fac-ruthenium(II) tris-(5-carboxy-2,2'-bipyridine) has been synthesised as a single geometric isomer for the first time, and proves to be a good "building-block" to introduce new functionality with retention of the isomeric integrity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Volatile organic compound (VOC) contamination of subsurface geological material and groundwater was discovered on the Nortel Monkstown industrial site, Belfast, Northern Ireland. The objectives of this study were to (1) investigate the characteristics of the geological material and its influences on contaminated groundwater flow across the site using borehole logs and hydrological evaluations, and (2) identify the contaminants and examine their distribution in the subsurface geological material and groundwater using chemical analysis. This report focuses on the eastern car park (ECP) which was a former storage area associated with trichloroethene (TCE) degreasing operations. This is where the greatest amount of volatile organic compounds (VOCs), particularly TCE, were detected. The study site is on a complex deposit of clayey glacial till with discontinuous coarser grained lenses, mainly silts, sands and gravel, which occur at 0.45–7.82 m below ground level (bgl). The lenses overall form an elongated formation that acts as a small unconfined shallow aquifer. There is a continuous low permeable stiff clayey till layer beneath the lenses that performs as an aquitard to the groundwater. Highest concentrations of VOCs, mainly TCE, in the geological material and groundwater are in these coarser lenses at ~4.5–7 m bgl. Highest TCE measurements at 390,000 µg L-1 for groundwater and at 39,000 µg kg-1 at 5.7 m for geological material were in borehole GA19 in the coarse lens zone. It is assumed that TCE gained entrance to the subsurface near this borehole where the clayey till was thin to absent above coarse lenses which provided little retardation to the vertical migration of this dense non-aqueous phase liquid (DNAPL) into the groundwater. However, TCE is present in low concentrations in the geological material overlying the coarse lens zone. Additionally, VOCs appear to be associated with poorly drained layers and in peat