Synthesis and in Vitro and in Vivo Evaluation of a Series of Dihydroisocoumarin Derivatives Conjugated with Fatty Acids, Alcohols, and Amines as Potential Anticancer Agents

In this paper, we report the synthesis and biological activity of a series of dihydroisocoumarin analogues Conjugated with fatty acids, alcohols, or amines, of varying hydrocarbon chain length and degree of unsaturation, to (he dihydroisocoumarins, kigelin and mellein, at the C-7 and C-8 positions on the core dihydroisocoumarin structure. These compounds were evaluated for their antiproliferative activity against human breast cancer (MCF-7 and MDA-MB-468) and melanoma cells (SK-MEL-28 and Malme-3M) using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay. Two compounds Conjugated with gamma-linolenyl alcohol (18:3 n-6) demonstrated potent antiproliferative activity in vitro with one of these 4-hydroxy-3-oxo-1.3-dihydro-isobenzofuran-5-carboxylic acid octadeca-6,9,12-trienyl ester, demonstrating significant antitumor activity in vivo ill a number of human tumor xenograft models.

A simple inhibition coefficient for quantifying potency of biocontrol agents against plant-pathogenic fungi

Microbial interactions depend on a range of biotic and environmental variables, and are both dynamic and unpredictable. For some purposes, and under defined conditions, it is nevertheless imperative to evaluate the inhibitory efficacy of microbes, such as those with potential as biocontrol agents. We selected six, phylogenetically diverse microbes to determine their ability to inhibit the ascomycete Fusarium
coeruleum, a soil-dwelling pathogen of potato tubers that causes the storage disease dry rot. Interaction assays, where colony development was quantified (for both fungal pathogen and potential control agents), were therefore carried out on solid media. The key parameters that contributed to, and were indicative of, inhibitory efficacy were identified as: fungal growth-rates (i) prior to contact with the biocontrol
agent and (ii) if/once contact with the biocontrol agent was established (i.e. in the zone of mixed
culture), and (iii) the ultimate distance traveled by the fungal mycelium. It was clear that there was no correlation between zones of fungal inhibition and the overall reduction in the extent of fungal colony development. An inhibition coefficient was devised which incorporated the potential contributions of distal inhibition of fungal growth-rate; prevention of mycelium development in the vicinity of the biocontrol
agent; and ability to inhibit plant-pathogen growth-rate in the zone of mixed culture (in a ratio of 2:2:1). The values derived were 84.2 for Bacillus subtilis (QST 713), 74.0 for Bacillus sp. (JC12GB42), 30.7 for Pichia anomala (J121), 19.3 for Pantoea agglomerans (JC12GB34), 13.9 for Pantoea sp. (S09:T:12), and
21.9 (indicating a promotion of fungal growth) for bacterial strain (JC12GB54). This inhibition coefficient, with a theoretical maximum of 100, was consistent with the extent of F. coeruleum-colony development (i.e. area, in cm2) and assays of these biocontrol agents carried out previously against Fusarium
spp., and other fungi. These findings are discussed in relation to the dynamics and inherent complexity of natural ecosystems, and the need to adapt models for use under specific sets of conditions.

Aggregation and neurotoxicity of alpha-synuclein and related peptides

Fibrillar deposits of alpha-synuclein occur in several neurodegenerative diseases. Two mutant forms of alpha-synuclein have been associated with early-onset Parkinson's disease, and a fragment has been identified as the non-amyloid-beta peptide component of Alzheimer's disease amyloid (NAC). Upon aging, solutions of alpha-synuclein and NAC change conformation to beta-sheet, detectable by CD spectroscopy, and form oligomers that deposit as amyloid-like fibrils, detectable by electron microscopy. These aged peptides are also neurotoxic. Experiments on fragments of NAC have enabled the region of NAC responsible for its aggregation and toxicity to be identified. NAC(8-18) is the smallest fragment that aggregates, as indicated by the concentration of peptide remaining in solution after 3 days, and forms fibrils, as determined by electron microscopy. Fragments NAC(8-18) and NAC(8-16) are toxic, whereas NAC(12-18), NAC(9-16) and NAC(8-15) are not. Hence residues 8-16 of NAC comprise the region crucial for toxicity. Toxicity induced by alpha-synuclein, NAC and NAC(1-18) oligomers occurs via an apoptotic mechanism, possibly initiated by oxidative damage, since these peptides liberate hydroxyl radicals in the presence of iron. Molecules with anti-aggregational and/or antioxidant properties may therefore be potential therapeutic agents.

Effects of the aurora kinase inhibitors AZD1152-HQPA and ZM447439 on growth arrest and polyploidy in acute myeloid leukemia cell lines and primary blasts.

BACKGROUND:
Aurora kinases play an essential role in the orchestration of chromosome separation and cytokinesis during mitosis. Small-molecule inhibition of the aurora kinases has been shown to result in inhibition of cell division, phosphorylation of histone H3 and the induction of apoptosis in a number of cell systems. These characteristics have led aurora kinase inhibitors to be considered as potential therapeutic agents.
DESIGN AND METHODS:
Aurora kinase gene expression profiles were assessed in 101 samples from patients with acute myeloid leukemia. Subsequently, aurora kinase inhibitors were investigated for their in vitro effects on cell viability, histone H3 phosphorylation, cell cycle and morphology in acute myeloid leukemia cell lines and primary acute myeloid leukemia samples.
RESULTS:
The aurora kinase inhibitors AZD1152-HQPA and ZM447439 induced growth arrest and the accumulation of hyperploid cells in acute myeloid leukemia cell lines and primary acute myeloid leukemia cultures. Furthermore, both agents inhibited histone H3 phosphorylation and this preceded perturbations in cell cycle and the induction of apoptosis. Single cell cloning assays were performed on diploid and polyploid cells to investigate their colony-forming capacities. Although the polyploid cells showed a reduced capacity for colony formation when compared with their diploid counterparts, they were consistently able to form colonies.
CONCLUSIONS:
AZD1152-HQPA- and ZM447439 are effective apoptosis-inducing agents in acute myeloid leukemia cell lines and primary acute myeloid leukemia cultures. However, their propensity to induce polyploidy does not inevitably result in apoptosis.

Improved biological activity of Gly(2)- and Ser(2)-substituted analogues of glucose-dependent insulinotrophic polypeptide

The therapeutic potential of glucagon-like peptide-1 (GLP-1) in improving glycaemic control in diabetes has been widely studied, but the potential beneficial effects of glucose-dependent insulinotropic polypeptide (GIP) have until recently been almost overlooked. One of the major problems, however, in exploiting either GIP or GLP-1 as potential therapeutic agents is their short duration of action, due to enzymatic degradation in vivo by dipeptidylpeptidase IV (DPP IV). Therefore, this study examined the plasma stability, biological activity and antidiabetic potential of two novel NH2-terminal Ala(2)-substituted analogues of GIP, containing glycine (Gly) or serine (Ser). Following incubation in plasma, (Ser(2))GIP had a reduced hydrolysis rate compared with native GIP, while (Gly(2))GIP was completely stable. In Chinese hamster lung fibroblasts stably transfected with the human GIP receptor, GIP, (Gly(2))GIP and (Ser(2))GIP stimulated cAMP production with EC50 values of 18.2, 14.9 and 15.0 nM respectively. In the pancreatic BRIN-BD1 beta-cell line, (Gly(2))GIP and (Ser(2))GIP (10(-8) M) evoked significant increases (1.2- and 1.5-fold respectively; P

Abeta oligomer toxicity inhibitor protects memory in models of synaptic toxicity

BACKGROUND AND PURPOSE:

Amyloid-ß (Aß) aggregation into synaptotoxic, prefibrillar oligomers is a major pathogenic event underlying the neuropathology of Alzheimer's disease (AD). The pharmacological and neuroprotective properties of a novel Aß aggregation inhibitor, SEN1269, were investigated on aggregation and cell viability and in test systems relevant to synaptic function and memory, using both synthetic Aß(1-42) and cell-derived Aß oligomers.
EXPERIMENTAL APPROACH:

Surface plasmon resonance studies measured binding of SEN1269 to Aß(1-42) . Thioflavin-T fluorescence and MTT assays were used to measure its ability to block Aß(1-42) -induced aggregation and reduction in cell viability. In vitro and in vivo long-term potentiation (LTP) experiments measured the effect of SEN1269 on deficits induced by synthetic Aß(1-42) and cell-derived Aß oligomers. Following i.c.v. administration of the latter, a complex (alternating-lever cyclic ratio) schedule of operant responding measured effects on memory in freely moving rats.
KEY RESULTS:

SEN1269 demonstrated direct binding to monomeric Aß(1-42) , produced a concentration-related blockade of Aß(1-42) aggregation and protected neuronal cell lines exposed to Aß(1-42) . In vitro, SEN1269 alleviated deficits in hippocampal LTP induced by Aß(1-42) and cell-derived Aß oligomers. In vivo, SEN1269 reduced the deficits in LTP and memory induced by i.c.v. administration of cell-derived Aß oligomers.
CONCLUSIONS AND IMPLICATIONS:

SEN1269 protected cells exposed to Aß(1-42) , displayed central activity with respect to reducing Aß-induced neurotoxicity and was neuroprotective in electrophysiological and behavioural models of memory relevant to Aß-induced neurodegeneration. It represents a promising lead for designing inhibitors of Aß-mediated synaptic toxicity as potential neuroprotective agents for treating AD.

P2Y(1) antagonists: Combining receptor-based modeling and QSAR for a quantitative prediction of the biological activity based on consensus scoring

P2Y(1) is an ADP-activated G protein-coupled receptor (GPCR). Its antagonists impede platelet aggregation in vivo and are potential antithrombotic agents. Combining ligand and structure-based modeling we generated a consensus model (LIST-CM) correlating antagonist structures with their potencies. We docked 45 antagonists into our rhodopsin-based human P2Y(1) homology model and calculated docking scores and free binding energies with the Linear Interaction Energy (LIE) method in continuum-solvent. The resulting alignment was also used to build QSAR based on CoMFA, CoMSIA, and molecular descriptors. To benefit from the strength of each technique and compensate for their limitations, we generated our LIST-CM with a PLS regression based on the predictions of each methodology. A test set featuring untested substituents was synthesized and assayed in inhibition of 2-MeSADP-stimulated PLC activity and in radioligand binding. LIST-CM outperformed internal and external predictivity of any individual model to predict accurately the potency of 75% of the test set.

Medusins: a new class of antimicrobial peptides from the skin secretions of phyllomedusine frogs

Natural drug discovery represents an area of research with vast potential. The investigation into the use of naturally-occurring peptides as potential therapeutic agents provides a new “chemical space” for the procurement of drug leads. Intensive and systematic studies on the broad-spectrum antimicrobial peptides found in amphibian skin secretions are of particular interest in the quest for new antibiotics to treat multiple drug-resistant bacterial infections. Here we report the molecular cloning of the biosynthetic precursor-encoding cDNAs and respective mature peptides representing a novel group of antimicrobial peptides from the skin secretions of representative species of phyllomedusine leaf frogs: the Central American red-eyed leaf frog (Agalychnis callidryas), the South American orange-legged leaf frog (Phyllomedusa hypochondrialis) and the Giant Mexican leaf frog, (Pachymedusa dacnicolor). Each novel peptide possessed the highly-conserved sequence, LGMIPL/VAISAISA/SLSKLamide, and each exhibited activity against the Gram-positive bacterium, Staphylococcus aureus and the yeast, Candida albicans, but all were devoid of haemolytic effects at concentrations up to and including the MICs for both organisms. The novel peptide group were named medusins, derived from the name of the hylid frog sub-family, Phyllomedusinae, to which all species investigated belong. These data clearly demonstrate that comparative studies of the skin secretions of phyllomedusine frogs can continue to produce novel peptides that have the potential to be leads in the development of new and effective antimicrobials.

A Novel Investigation of a Blister-Like Syndrome in Aquarium Echinopora lamellosa

This study investigates potential causes of a novel blister-like syndrome in the plating coral Echinopora lamellosa. Visual inspections of this novel coral syndrome showed no obvious signs of macroparasites and the blisters themselves manifested as fluid-filled sacs on the surface of the coral, which rose from the coenosarc between the coral polyps. Histological analysis of the blisters showed that there was no associated necrosis with the epidermal or gastrodermal tissues. The only difference between blistered areas and apparently healthy tissues was the presence of proliferated growth (possible mucosal cell hyperplasia) directly at the blister interface (area between where the edge of the blister joined apparently healthy tissue). No bacterial aggregates were identified in any histological samples, nor any sign of tissue necrosis identified. We conclude, that the blister formations are not apparently caused by a specific microbial infection, but instead may be the result of irritation following growth anomalies of the epidermis. However, future work should be conducted to search for other potential casual agents, including viruses. © 2014 Smith et al.

The Host Defence Peptide LL-37 is Susceptible to Proteolytic Degradation by Wound Fluid Isolated from Foot Ulcers of Diabetic Patients

The pleiotropic effects of host defence peptides (HDPs), including the ability to kill microorganisms, enhance re-epithelialisation and increase angiogenesis, indicates a role for these important peptides as potential therapeutic agents in the treatment of chronic, non-healing wounds. However, the maintenance of peptide integrity, through resistance to degradation by the array of proteinases present at the wound site, is a prerequisite for clinical success. In this study we explored the degradation of exogenous LL-37, one such HDP, by wound fluid from diabetic foot ulcers to determine its susceptibility to proteolytic degradation. Our results suggest that LL-37 is unstable in the diabetic foot ulcer microenvironment. Following overnight treatment with wound fluid, LL-37 was completely degraded. Analysis of cleavage sites suggested potential involvement of both host- and bacterial-derived proteinases. The degradation products were shown to retain some antibacterial activity against Pseudomonas aeruginosa but were inactive against Staphylococcus aureus. In conclusion, our data suggest that stabilising selected peptide bonds within the sequence of LL-37 would represent an avenue for future research prior to clinical studies to address its potential as an exogenously-applied therapeutic in diabetic wounds. 

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Epigenetics in Vascular Disease - Therapeutic Potential of New Agents

Vascular diseases, including atherosclerosis, angioplasty-induced restenosis, vessel graft arteriosclerosis and hypertension-related stenosis, remain the most prevalent cause of death in the developed world. The aetiology of vascular diseases is multifactorial with both genetic and environmental factors. Recently, some of the most promising research identifies the epigenetic modification of the genome to play a major role in the disease development, linking the environmental insults with gene regulation. In this process, modification of DNA by methylation, and histone modification by acetylation, methylation, phosphorylation and/or SUMOylation are reported. Importantly, recent studies demonstrated that histone deacetylase (HDAC) enzymes are crucial in endothelial integrity, smooth muscle proliferation and in the formation of arteriosclerosis in animal models. The study of HDACs has shown remarkable specificity of HDAC family members in vascular cell growth/death that influences the disease process. Interestingly, the effects of HDACs on arteriosclerosis development in animal models have been observed after HDAC inhibition using specific inhibitors. This provides a new approach for the treatment of vascular disease using the agents that influence the epigenetic process in vascular cells. This review updates the rapid advances in epigenetics of vascular diseases focusing on the role of HDAC family in atherosclerosis. It will also discuss the underlying mechanisms of histone acetylation in vascular cells and highlight the therapeutic potential of such agents.

Treatment of a cochlear implant biofilm infection: a potential role for alternative antimicrobial agents

OBJECTIVE:
This study aimed to investigate antimicrobial treatment of an infected cochlear implant, undertaken in an attempt to salvage the infected device.

METHODS:
We used the broth microdilution method to assess the susceptibility of meticillin-sensitive Staphylococcus aureus isolate, cultured from an infected cochlear implant, to common antimicrobial agents as well as to novel agents such as tea tree oil. To better simulate in vivo conditions, where bacteria grow as microcolonies encased in glycocalyx, the bactericidal activity of selected antimicrobial agents against the isolate growing in biofilm were also compared.

RESULTS:
When grown planktonically, the S aureus isolate was susceptible to 17 of the 18 antimicrobials tested. However, when grown in biofilm, it was resistant to all conventional antimicrobials. In contrast, 5 per cent tea tree oil completely eradicated the biofilm following exposure for 1 hour.

CONCLUSION:
Treatment of infected cochlear implants with novel agents such as tea tree oil could significantly improve salvage outcome.

Potential of Microneedles in Enhancing Delivery of Photosensitising Agents for Photodynamic Therapy

Photodynamic therapy can be used in the treatment of pre-malignant and malignant diseases. It offers advantages over other therapies currently used in the treatment of skin lesions including avoidance of damage to surrounding tissue and minimal or no scarring. Unfortunately, systemic delivery of photosensitising agents can result in adverse effects, such as prolonged cutaneous photosensitivity; while topical administration lacks efficacy in the clearance of deeper skin lesions and those with a thick overlying keratotic layer. Therefore, enhancement of conventional photosensitiser delivery is desired. However, the physicochemical properties of photosensitising agents, such as extreme hydrophilicity or lipophilicity and large molecular weights make this challenging. This paper reviews the potential of microneedles as a viable method to overcome these delivery-limiting physicochemical characteristics and discusses the current benefits and limitations of solid, dissolving and hydrogel-forming microneedles. Clinical studies in which microneedles have successfully improved photodynamic therapy are also discussed, along with benefits which microneedles offer, such as precise photosensitiser localisation, painless application and reduction in waiting times between photosensitiser administration and irradiation highlighted.