134 resultados para Coloring Agents


Relevância:

60.00% 60.00%

Publicador:

Resumo:

Drug flux across microneedle (MN)-treated skin is influenced by the characteristics of the MN array, formed microconduits and physicochemical properties of the drug molecules in addition to the overall diffusional resistance of microconduits and viable tissue. Relative implication of these factors has not been fully explored. In the present study, the in vitro permeation of a series of six structurally related ionic xanthene dyes with different molecular weights (MW) and chemical substituents, across polymer MN-pretreated porcine skin was investigated in relation of their molecular characteristics. Dyes equilibrium solubility, partition coefficient in both n-octanol or porcine skin/aqueous system, and dissociation constants were determined. Results indicated that for rhodamine dyes, skin permeation of the zwitterionic form which predominates at physiological pH, was significantly reduced by an increase in MW, the skin thickness and by the presence of the chemically reactive isothiocyanate substituent. These factors were generally shown to override the aqueous solubility, an important determinant of drug diffusion in an aqueous milieu. The data obtained provided more insight into the mechanism of drug permeation across MN-treated skin, which is of importance to both the design of MN-based transdermal drug delivery systems and of relevance to skin permeation research.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

BACKGROUND: Cigarette smoking is one of the most significant risk factors in the development and further advancement of inflammatory periodontal disease, however, the role of either nicotine or its primary metabolite cotinine in the progression of periodontitis is unclear. This study aimed to investigate the effects of nicotine and cotinine on the attachment and growth of fibroblasts derived from human periodontal ligament (PDL).

METHODS: Primary cultures were prepared from the roots of extracted premolar teeth. Cells were used at both low (P3 to P5) and high (P11 to P13) passage. Cell numbers were determined over 14 days using either the 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide (MTT) assay or with a Coulter counter. Cultures were exposed to culture medium supplemented with 1) 15% fetal calf serum (FCS) only; 2) 1% FCS only; 3) 1% FCS and nicotine (concentration range 5 ng/ml to 10 mg/ml); or 4) 1% FCS and cotinine (concentration range 0.5 ng/ml to 10 microg/ml).

RESULTS: Nicotine significantly (P <0.05, by ANOVA) inhibits attachment and growth of low passage cells at concentrations >1 mg/ml and high passage PDL fibroblasts at concentrations >0.5 mg/ml. Cotinine, at the highest concentration used (10 microg/ml), appeared to inhibit attachment and growth of both low and high passage fibroblasts but this was not statistically significant (P >0.05, by ANOVA).

CONCLUSIONS: Tobacco products inhibit attachment and growth of human PDL fibroblasts. This may partly explain the role of these substances in the progression of periodontitis.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

BACKGROUND AND OBJECTIVE: The main difficulty of PCR-based clonality studies for B-cell lymphoproliferative disorders (B-LPD) is discrimination between monoclonal and polyclonal PCR products, especially when there is a high background of polyclonal B cells in the tumor sample. Actually, PCR-based methods for clonality assessment require additional analysis of the PCR products in order to discern between monoclonal and polyclonal samples. Heteroduplex analysis represents an attractive approach since it is easy to perform and avoids the use of radioactive substrates or expensive equipment. DESIGN AND METHODS: We studied the sensitivity and specificity of heteroduplex PCR analysis for monoclonal detection in samples from 90 B-cell non Hodgkin's lymphoma (B-NHL) patients and in 28 individuals without neoplastic B-cell disorders (negative controls). Furthermore, in 42 B-NHL and in the same 28 negative controls, we compared heteroduplex analysis vs the classical PCR technique. We also compared ethidium bromide (EtBr) vs. silver nitrate (AgNO(3)) staining as well as agarose vs. polyacrylamide gel electrophoresis (PAGE). RESULTS: Using two pair consensus primers sited at VH (FR3 and FR2) and at JH, 91% of B-NHL samples displayed monoclonal products after heteroduplex PCR analysis using PAGE and AgNO(3) staining. Moreover, no polyclonal sample showed a monoclonal PCR product. By contrast, false positive results were obtained when using agarose (5/28) and PAGE without heteroduplex analysis: 2/28 and 8/28 with EtBr and AgNO(3) staining, respectively. In addition, false negative results only appeared with EtBr staining: 13/42 in agarose, 4/42 in PAGE without heteroduplex analysis and 7/42 in PAGE after heteroduplex analysis. INTERPRETATION AND CONCLUSIONS: We conclude that AgNO(3) stained PAGE after heteroduplex analysis is the most suitable strategy for detecting monoclonal rearrangements in B-NHL samples because it does not produce false-positive results and the risk of false-negative results is very low.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The relative sensitivity of neoplastic cells to DNA damaging agents is a key factor in cancer therapy. In this paper, we show that pretreatment of Burkitt's lymphoma cell lines expressing the c-met protooncogene with hepatocyte growth factor (HGF) protects them from death induced by DNA damaging agents commonly used in tumour therapy. This protection was observed in assays based on morphological assessment of apoptotic cells and DNA fragmentation assays. The protection was dose- and time-dependent — maximal protection requiring pre-incubation with 100 ng/ml HGF for 48 h. Western blotting analysis and flow cytometric studies revealed that HGF inhibited doxorubicin- and etoposide-induced decreases in the levels of the anti-apoptotic proteins Bcl-XL, and to a lesser extent Bcl-2, without inducing changes in the pro-apoptotic Bax protein. Overall, these studies suggest that the accumulation of HGF within the microenvironment of neoplastic cells may contribute to the development of a chemoresistant phenotype.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

BRCA1 is a tumour suppressor gene implicated in the predisposition to early onset breast and ovarian cancer. We have generated cell lines with inducible expression of BRCA1 to evaluate its role in mediating the cellular response to various chemotherapeutic drugs commonly used in the treatment of breast and ovarian cancer. Induction of BRCA1 in the presence of Taxol and Vincristine resulted in a dramatic increase in cell death; an effect that was preceded by an acute arrest at the G2/M phase of the cell cycle and which correlated with BRCA1 mediated induction of GADD45. A proportion of the arrested cells were blocked in mitosis suggesting activation of both a G2 and a mitotic spindle checkpoint. In contrast, no specific interaction was observed between BRCA1 induction and treatment of cells with a range of DNA damaging agents including Cisplatin and Adriamycin. Inducible expression of GADD45 in the presence of Taxol induced both G2 and mitotic arrest in these cells consistent with a role for GADD45 in contributing to these effects. Our results support a role for both BRCA1 and GADD45 in selectively regulating a G2/M checkpoint in response to antimicrotubule agents and raise the possibility that their expression levels in cells may contribute to the toxicity observed with these compounds.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.