159 resultados para sequence homology
em Indian Institute of Science - Bangalore - Índia
Resumo:
Background & objectives: Periplasmic copper and zinc superoxide dismutase (Cu,Zn-SOD or SodC) is an important component of the antioxidant shield which protects bacteria from the phagocytic oxidative burst. Cu,Zn-SODs protect Gram-negative bacteria against oxygen damage which have also been shown to contribute to the pathogenicity of these bacterial species. We report the presence of SodC in drug resistant Salmonella sp. isolated from patients suffering from enteric fever. Further sodC was amplified, cloned into Escherichia coli and the nucleotide sequence and amino acid sequence homology were compared with the standard strain Salmonella Typhimurium 14028. Methods: Salmonella enterica serovar Typhi (S. Typhi) and Salmonellaenterica serovar Paratyphi (S. Paratyphi) were isolated and identified from blood samples of the patients. The isolates were screened for the presence of Cu, Zn-SOD by PAGE using KCN as inhibitor of Cu,Zn-SOD. The gene (sodC) was amplified by PCR, cloned and sequenced. The nucleotide and amino acid sequences of sodC were compared using CLUSTAL X.Results: SodC was detected in 35 per cent of the Salmonella isolates. Amplification of the genomic DNA of S. Typhi and S. Paratyphi with sodC specific primers resulted in 519 and 515 bp amplicons respectively. Single mutational difference at position 489 was observed between thesodC of S. Typhi and S. Paratyphi while they differed at 6 positions with the sodC of S. Typhimurium 14028. The SodC amino acid sequences of the two isolates were homologous but 3 amino acid difference was observed with that of standard strain S. Typhimurium 14028.Interpretation & conclusions: The presence of SodC in pathogenic bacteria could be a novel candidate as phylogenetic marker.
Resumo:
The genomic sequences of several RNA plant viruses including cucumber mosaic virus, brome mosaic virus, alfalfa mosaic virus and tobacco mosaic virus have become available recently. The former two viruses are icosahedral while the latter two are bullet and rod shaped, respectively in particle morphology. The non-structural 3a proteins of cucumber mosaic virus and brome mosaic virus have an amino acid sequence homology of 35% and hence are evolutionarily related. In contrast, the coat proteins exhibit little homology, although the circular dichroism spectrum of these viruses are similar. The non-coding regions of the genome also exhibit variable but extensive homology. Comparison of the brome mosaic virus and alfalfa mosaic virus sequences reveals that they are probably related although with a much larger evolutionary distance. The polypeptide folds of the coat protein of three biologically distinct isometric plant viruses, tomato bushy stunt virus, southern bean mosaic virus and satellite tobacco necrosis virus have been shown to display a striking resemblance. All of them consist of a topologically similar 8-standard β-barrel. The implications of these studies to the understanding of the evolution of plant viruses will be discussed.
Resumo:
The evolutionary diversity of the HSP70 gene family at the genetic level has generated complex structural variations leading to altered functional specificity and mode of regulation in different cellular compartments. By utilizing Saccharomyces cerevisiae as a model system for better understanding the global functional cooperativity between Hsp70 paralogs, we have dissected the differences in functional properties at the biochemical level between mitochondrial heat shock protein 70 (mtHsp70) Ssc1 and an uncharacterized Ssc3 paralog. Based on the evolutionary origin of Ssc3 and a high degree of sequence homology with Ssc1, it has been proposed that both have a close functional overlap in the mitochondrial matrix. Surprisingly, our results demonstrate that there is no functional cross-talk between Ssc1 and Ssc3 paralogs. The lack of in vivo functional overlap is due to altered conformation and significant lower stability associated with Ssc3. The substrate-binding domain of Ssc3 showed poor affinity toward mitochondrial client proteins and Tim44 due to the open conformation in ADP-bound state. In addition to that, the nucleotide-binding domain of Ssc3 showed an altered regulation by the Mge1 co-chaperone due to a high degree of conformational plasticity, which strongly promotes aggregation. Besides, Ssc3 possesses a dysfunctional inter-domain interface thus rendering it unable to perform functions similar to generic Hsp70s. Moreover, we have identified the critical amino acid sequence of Ssc1 and Ssc3 that can ``make or break'' mtHsp70 chaperone function. Together, our analysis provides the first evidence to show that the nucleotide-binding domain of mtHsp70s plays a critical role in determining the functional specificity among paralogs and orthologs across kingdoms.
Resumo:
The translation elongation factor G (EFG) is encoded by the fusA gene.Several bacteria possess a second fusA-like locus,fusA2 which encodes EFG2. A comparison of EFG and EFG2 from various bacteria reveals that EFG2 preserves domain organization and maintains significant sequence homology with EFG, suggesting that EFG2 may function as an elongation factor. However, with the single exception of a recent study on Thermus thermophilus EFG2, this class of EFG-like factors has not been investigated. Here, we have characterized EFG2 (MSMEG_6535) from Mycobacterium smegmatis. Expression of EFG2 was detected in stationary phase cultures of M.smegmatis (Msm). Our in vitro studies show that while MsmEFG2 binds guanine nucleotides, it lacks the ribosome-dependent GTPase activity characteristic of EFGs. Furthermore,unlike MsmEFG (MSMEG_1400), MsmEFG2 failed to rescue an E. coli strain harboring a temperature-sensitive allele of EFG, for its growth at thenon-permissive temperature. Subsequent experiments showed that the fusA2 gene could be disrupted in M. smegmatis mc(2)155 with Kan(R)marker. The M. smegmatis fusA2::kan strain was viable and showed growth kinetics similar to that of the parent strain (wild-type for fusA2).However, in the growth competition assays, the disruption of fusA2 was found to confer a fitness disadvantage to M. smegmatis, raising the possibility that EFG2 is of some physiological relevance to mycobacteria.
Resumo:
Previous studies have shown predominant association of G10P11 type bovine rotavirus-derived reassortant strains with asymptomatic infections in newborn children in India. To understand the epidemiological and genetic basis for the origin of these strains in humans, the relative frequencies of different serotypes among bovine rotaviruses (BRVs) isolated from southern, western and central regions of the country were determined by subgroup and serotype analysis as well as nucleotide (nt) sequence analysis of the genes encoding the outer capsid proteins VP4 and VP7. Since the human G10P11 asymptomatic neonatal strain I321 possessed NSP1 from a human rotavirus, to determine its genetic origin in the bovine strains, comparative analysis of partial gene sequences from representative G10P11 strains was also carried out. The following observations were of great epidemiological significance, (i) G10P11 strains predominated in all the three regions with frequencies ranging between 55.6% and 85.2%. In contrast to the high prevalence of G6 strains in other countries, only one G6 strain was detected in this study and G8 strains represented 5.8% of the isolates, (ii) among the G10 strains, in serotyping ELISA, four patterns of reactivity were observed that appeared to correlate with the differences in electropherotypic patterns and amino acid (aa) sequence of the VP7, (iii) surprisingly, strains belonging to serotype G3 were detected more frequently (10.7%) than those of serotypes G6 and G8 combined, while strains representing the new serotype (G15) were observed in a single farm in Bangalore, and (iv) about 3.9% of the isolates were nontypeable as they exhibited high cross-reactivity to the serotyping MAbs used in the study. Comparative analysis of the VP7 gene sequence from the prototype G3 MAb-reactive bovine strain J63 revealed greatest sequence relatedness (87.6% nt and 96.0% aa) with that of serotype G3 rhesus-monkey strain RRV. It also exhibited high sequence homology with the VP7 from several animal and animal rotavirus-related human G3 strains (Simian SA11; equine ERV316 and FI-14. canine CU-1 and K9; porcine 4F; Feline Cat2 and human HCR3, YO and AU1). Partial nucleotide sequence analysis of the NSP1 gene of J63 showed greatest nt sequence homology (95.9%) to the NSP1 gene allele of the Indian G8 strain, isolated from a diarrheic child, which is likely to have been transmitted directly from cattle and 92.6% homology to that of the bovine G8 strain A5-10 suggesting the likely origin of J63 by gene reassortment between a bovine G8 strain and a G3 animal strain. Prevalence of G10P11 strains in cattle and G10P11 or P11 type reassortant strains in asymptomatic neonates as well as detection of G8P[1] strains in diarrheic children support our hypothesis for bidirectional transmission of rotaviruses between humans and cattle and origin of novel strains catalyzed by the age-old traditions and socio-economic conditions in India.
Resumo:
The occurrence of DNA architectural proteins containing two functional domains derived from two different architectural proteins is an interesting emerging research theme in the field of nucleoid structure and function. Mycobacterium tuberculosis HupB, unlike Escherichia coli HU, is a two-domain protein that, in the N-terminal region, shows broad sequence homology with bacterial HU. The long C-terminal extension, on the other hand, contains seven PAKK/KAAK motifs, which are characteristic of the histone H1/H5 family of proteins. In this article, we describe several aspects of HupB function, in comparison with its truncated derivatives lacking either the C-terminus or N-terminus. We found that HupB binds a variety of DNA repair and replication intermediates with K(d) values in the nanomolar range. By contrast, the N-terminal fragment of M. tuberculosis HupB (HupB(MtbN)) showed diminished DNA-binding activity, with K(d) values in the micromolar range, and the C-terminal domain was completely devoid of DNA-binding activity. Unlike HupB(MtbN), HupB was able to constrain DNA in negative supercoils and introduce negative superhelical turns into relaxed DNA. Similarly, HupB exerted a robust inhibitory effect on DNA strand exchange promoted by cognate and noncognate RecA proteins, whereas HupB(MtbN), even at a 50-fold molar excess, had no inhibitory effect. Considered together, these results suggest that synergy between the N-terminal and C-terminal domains of HupB is essential for its DNA-binding ability, and to modulate the topological features of DNA, which has implications for processes such as DNA compaction, gene regulation, homologous recombination, and DNA repair.
Resumo:
The fidelity of the folding pathways being encoded in the amino acid sequence is met with challenge in instances where proteins with no sequence homology, performing different functions and no apparent evolutionary linkage, adopt a similar fold. The problem stated otherwise is that a limited fold space is available to a repertoire of diverse sequences. The key question is what factors lead to the formation of a fold from diverse sequences. Here, with the NAD(P)-binding Rossmann fold domains as a case study and using the concepts of network theory, we have unveiled the consensus structural features that drive the formation of this fold. We have proposed a graph theoretic formalism to capture the structural details in terms of the conserved atomic interactions in global milieu, and hence extract the essential topological features from diverse sequences. A unified mathematical representation of the different structures together with a judicious concoction of several network parameters enabled us to probe into the structural features driving the adoption of the NAD(P)-binding Rossmann fold. The atomic interactions at key positions seem to be better conserved in proteins, as compared to the residues participating in these interactions. We propose a ``spatial motif'' and several ``fold specific hot spots'' that form the signature structural blueprints of the NAD(P)-binding Rossmann fold domain. Excellent agreement of our data with previous experimental and theoretical studies validates the robustness and validity of the approach. Additionally, comparison of our results with statistical coupling analysis (SCA) provides further support. The methodology proposed here is general and can be applied to similar problems of interest.
Resumo:
The evolutionary diversity of the HSP70 gene family at the genetic level has generated complex structural variations leading to altered functional specificity and mode of regulation in different cellular compartments. By utilizing Saccharomyces cerevisiae as a model system for better understanding the global functional cooperativity between Hsp70 paralogs, we have dissected the differences in functional properties at the biochemical level between mitochondrial heat shock protein 70 (mtHsp70) Ssc1 and an uncharacterized Ssc3 paralog. Based on the evolutionary origin of Ssc3 and a high degree of sequence homology with Ssc1, it has been proposed that both have a close functional overlap in the mitochondrial matrix. Surprisingly, our results demonstrate that there is no functional cross-talk between Ssc1 and Ssc3 paralogs. The lack of in vivo functional overlap is due to altered conformation and significant lower stability associated with Ssc3. The substrate-binding domain of Ssc3 showed poor affinity toward mitochondrial client proteins and Tim44 due to the open conformation in ADP-bound state. In addition to that, the nucleotide-binding domain of Ssc3 showed an altered regulation by the Mge1 co-chaperone due to a high degree of conformational plasticity, which strongly promotes aggregation. Besides, Ssc3 possesses a dysfunctional inter-domain interface thus rendering it unable to perform functions similar to generic Hsp70s. Moreover, we have identified the critical amino acid sequence of Ssc1 and Ssc3 that can “make or break” mtHsp70 chaperone function. Together, our analysis provides the first evidence to show that the nucleotide-binding domain of mtHsp70s plays a critical role in determining the functional specificity among paralogs and orthologs across kingdoms.
Resumo:
Jacalin and artocarpin, the two lectins from jackfruit (Artocarpus integrifolia) seeds, have different physicochemical properties and carbohydrate-binding specificities. However, comparison of the partial amino-acid sequence of artocarpin with the known sequence of jacalin indicates close to 50% sequence identity. Artocarpin crystallizes in two forms, both monoclinic P2(1), with one and two tetramic molecules, respectively, in the asymmetric units of form I (a = 69.9, b = 73.7, c = 60.6 Angstrom and beta = 95.1 degrees) and form II (a = 87.6, b = 72.2, c = 92.6 Angstrom and beta = 101.1 degrees). Both the crystal structures have been solved by the molecular replacement method using the known structure of jacalin as the search model and ope of them partially refined, confirming that the two lectins are indeed homologous.
Resumo:
The discovery of GH (Glycoside Hydrolase) 19 chitinases in Streptomyces sp. raises the possibility of the presence of these proteins in other bacterial species, since they were initially thought to be confined to higher plants. The present study mainly concentrates on the phylogenetic distribution and homology conservation in GH19 family chitinases. Extensive database searches are performed to identify the presence of GH19 family chitinases in the three major super kingdoms of life. Multiple sequence alignment of all the identified GH19 chitinase family members resulted in the identification of globally conserved residues. We further identified conserved sequence motifs across the major sub groups within the family. Estimation of evolutionary distance between the various bacterial and plant chitinases are carried out to better understand the pattern of evolution. Our study also supports the horizontal gene transfer theory, which states that GH19 chitinase genes are transferred from higher plants to bacteria. Further, the present study sheds light on the phylogenetic distribution and identifies unique sequence signatures that define GH19 chitinase family of proteins. The identified motifs could be used as markers to delineate uncharacterized GH19 family chitinases. The estimation of evolutionary distance between chitinase identified in plants and bacteria shows that the flowering plants are more related to chitinase in actinobacteria than that of identified in purple bacteria. We propose a model to elucidate the natural history of GH19 family chitinases.
Resumo:
Over the past two decades, many ingenious efforts have been made in protein remote homology detection. Because homologous proteins often diversify extensively in sequence, it is challenging to demonstrate such relatedness through entirely sequence-driven searches. Here, we describe a computational method for the generation of `protein-like' sequences that serves to bridge gaps in protein sequence space. Sequence profile information, as embodied in a position-specific scoring matrix of multiply aligned sequences of bona fide family members, serves as the starting point in this algorithm. The observed amino acid propensity and the selection of a random number dictate the selection of a residue for each position in the sequence. In a systematic manner, and by applying a `roulette-wheel' selection approach at each position, we generate parent family-like sequences and thus facilitate an enlargement of sequence space around the family. When generated for a large number of families, we demonstrate that they expand the utility of natural intermediately related sequences in linking distant proteins. In 91% of the assessed examples, inclusion of designed sequences improved fold coverage by 5-10% over searches made in their absence. Furthermore, with several examples from proteins adopting folds such as TIM, globin, lipocalin and others, we demonstrate that the success of including designed sequences in a database positively sensitized methods such as PSI-BLAST and Cascade PSI-BLAST and is a promising opportunity for enormously improved remote homology recognition using sequence information alone.
Resumo:
Protein functional annotation relies on the identification of accurate relationships, sequence divergence being a key factor. This is especially evident when distant protein relationships are demonstrated only with three-dimensional structures. To address this challenge, we describe a computational approach to purposefully bridge gaps between related protein families through directed design of protein-like ``linker'' sequences. For this, we represented SCOP domain families, integrated with sequence homologues, as multiple profiles and performed HMM-HMM alignments between related domain families. Where convincing alignments were achieved, we applied a roulette wheel-based method to design 3,611,010 protein-like sequences corresponding to 374 SCOP folds. To analyze their ability to link proteins in homology searches, we used 3024 queries to search two databases, one containing only natural sequences and another one additionally containing designed sequences. Our results showed that augmented database searches showed up to 30% improvement in fold coverage for over 74% of the folds, with 52 folds achieving all theoretically possible connections. Although sequences could not be designed between some families, the availability of designed sequences between other families within the fold established the sequence continuum to demonstrate 373 difficult relationships. Ultimately, as a practical and realistic extension, we demonstrate that such protein-like sequences can be ``plugged-into'' routine and generic sequence database searches to empower not only remote homology detection but also fold recognition. Our richly statistically supported findings show that complementary searches in both databases will increase the effectiveness of sequence-based searches in recognizing all homologues sharing a common fold. (C) 2013 Elsevier Ltd. All rights reserved.
Resumo:
NrichD
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.