Alterations in the activities of the enzymes of proline metabolism in Ragi (Eleusine coracana) leaves during water stress

Free proline content in Ragi (Eleusine coracana) leaves increased markedly (6 to 85 fold) as the degree of water stress, created by polyethylene gylcol treatment, was prolonged There was also a marginal increase in soluble proteins in the stressed leaves as compared to that in the controls. Water stress stimulated the activities of ornithine aminotransferase and pyrroline-5-carboxylate reductase, the enzymes of proline biosynthesis and markedly inhibited the enzymes involved in proline degradation viz., proline oxidase and pyrroline-5-carboxylate dehydrogenase. These results suggest that increase in free proline content of Ragi leaves could be due to enhanced activities of the enzymes synthesizing proline but more importantly due to severe inhibition of the enzymes degrading proline. These observations establish for the first time, the pathway of proline metabolism in plants by way of detection of the activities of all the enzymes involved and also highlight the role of these enzymes in proline accumulation during water stress.

Water stress induced alterations in ornithine aminotransferase of ragi (Eleusine coracana): Protection by proline against heat inactivation and denaturation by urea and guanidinium chloride

Water stress resulted in a specific response leading to a large and significant increase (80-fold) in free proline content of ragi (Eleusine coracana) leaves and seedlings. L-Proline protected ornithine aminotransferase, an enzyme in the pathway for proline biosynthesis, isolated from normal and stressed ragi leaves against heat inactivation and denaturation by urea and guanidinium chloride. The protection of the stressed enzyme by L-proline was much more complete than that of the enzyme isolated from normal leaves. While L-ornithine, one of the substrates, protected the stressed enzyme against inactivation, it enhanced the rate of inactivation of the normal enzyme. α-Ketoglutarate protected both the normal and stressed enzyme against inactivation and denaturation. These results support the suggestion that ornithine aminotransferase has undergone a structural alteration during water stress. In view of the causal relationship between elevated temperature and water stress of plants under natural conditions, the protection afforded by proline against inactivation and denaturation of the enzyme from stressed leaves assumes significance. These results provide an explanation for a possible functional importance of proline accumulation during water stress.

Geometry Of Proline And Hydroxyproline .1. An Analysis Of X-Ray Crystal-Structure Data

We have carried out an analysis of crystal structure data on prolyl and hydroxyprolyl moieties in small molecules. The flexibility of the pyrrolidine ring due to the pyramidal character of nitrogen has been defined in terms of two projection angles δ1 and δ2. The distribution of these parameters in the crystal structures is found to be consistent with results of the energy calculations carried out on prolyl moieties in our laboratory.

Proline ring conformations corresponding to a bistable jump model from 13C spin-lattice relaxation times

A formalism for extracting the conformations of a proline ring based on the bistable jump model of R. E. London [(1978) J. Am. Chem. Soc. 100, 2678-2685] from 13C spin-lattice relaxation times (T1) is given. The method is such that the relaxation data are only partially used to generate the conformations; these conformations are constrained to satisfy the rest of the relaxation data and to yield acceptable ring geometry. An alternate equation for T1 of 13C nuclei to that of London is given. The formalism is illustrated through an example.

Proline-containing β-turns in peptides and proteins: Analysis of structural data on globular proteins

Tetrapeptide sequences of the type Z-Pro-Y-X were obtained from the crystal structure data on 34 globular proteins, and used in an analysis of the positional preferences of the individual amino acid residues in the β-turn conformation. The effect of fixing proline as the second position residue in the tetrapeptide sequence was studied by comparing the data obtained on the positional preferences with the corresponding data obtained by Chou and Fasman using the Z-R-Y-X sequence, where no particular residue was fixed in any of the four positions. While, in general, several amino acid residues having relatively very high or very low preferences for specific positions were found to be common to both the Z-Pro-Y-X and Z-R-Y-X sequences, many significant differences were found between the two sets of data, which are to be attributed to specific interactions arising from the presence of the proline residue.

Crystal and molecular structure of allo-4-hydroxy-L-proline dihydrate

allo-4-Hydroxy-L-proline crystallizes from an aqueous solution as the dihydrate. The crystals are orthorhombic, space group P212121, with a=7.08 (2), b=22.13 (3), c= 5"20 (2) A,. The structure was solved by direct methods and refined by block-diagonal least squares. The final R for 733 observed reflexions is 0.054. The molecule exists as a zwitterion with hydroxyl and carboxyl groups cis to the pyrrolidine ring. The latter is puckered at the fl-carbon atom, which deviates by -0.54 A, from the best plane formed by the four remaining atoms. The molecules are held together by a network of hydrogen bonds, the water molecules playing a dominant role in the stability of the structure.

Conformations of Heterochiral and Homochiral Proline-Pseudoproline Segments in Peptides: Context Dependent Cis-Trans Peptide Bond Isomerization

The pseudoproline residue (Psi Pro, L-2,2-dimethyl-1,3-thiazolidine-4-carboxylic acid) has been introduced into heterochiral diproline segments that have been previously shown to facilitate the formation of beta-hairpins, containing central two and three residue turns. NMR studies of the octapeptide Boc-Leu-Phe-Val-(D)Pro-Psi Pro-Leu-Phe-Val-OMe (1), Boc-Leu-Val-Val-(D)Pro-Psi Pro-Leu-Val-Val-OMe (2), and the nonapeptide sequence Boc-Leu-Phe-Val-(D)Pro-Psi Pro-(D)Ala-Leu-Phe-Val-OMe (3) established well-registered beta-hairpin structures in chloroform solution, with the almost exclusive population of the trans conformation for the peptide bond preceding the Psi Pro residue. The beta-hairpin conformation of 1 is confirmed by single crystal X-ray diffraction. Truncation of the strand length in Boc-Val-(D)Pro-Psi Pro-Leu-OMe (4) results in air increase in the population of the cis conformer, with a cis/trans ratio of 3.65. Replacement of Psi Pro in 4 by (L)Pro in 5, results in almost exclusive population of the trans form, resulting in an incipient beta-hairpin conformation, stabilized by two intramolecular hydrogen bonds. Further truncation of the sequence gives an appreciable rise in the population of cis conformers in the tripeptide piv-(D)Pro-Psi Pro-Leu-OMe (6). In the homochiral segment Piv-Pro Psi Pro-Leu-OMe (7) only the cis form is observed with the NMR evidence strongly supporting a type VIa beta-turn conformation, stabilized by a 4 -> 1 hydrogen bond between the Piv (CO) and Leu (3) NH groups. The crystal structure of the analog peptide 7a (Piv-Pro-Psi(H,CH3)Pro-Leu-NHMe) confirms the cis peptide bond geometry for the Pro-Psi(H,CH3)pro peptide bond, resulting in a type VIa beta-turn conformation.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Rotational isomerism about the Ca-CO bond in proline derivatives. 1H and 13C NMR studies of benzyloxycarbonyl-Pro-N-methylamide and pivaloyl-Pro-N-methylamide

The 270 MHz 1H n.m.r. spectrum of benzyloxycarbonyl-Pro-N-methylamide in CDCl3 is exchange broadened at 293° K. Spectral lines due to two species are frozen out at 253° K and a dynamically averaged spectrum is obtained at 323° K. A selective broadening of the Cβ and Cγ resonances in the 13C n.m.r. spectrum is observed at 253° K, with a splitting of the Cβ and Cγ resonances into a pair of lines of unequal intensity. A similar broadening of Cβ and Cγ peaks is also detected in pivaloyl-Pro-N-methylamide where cis-trans interconversion about the imide bond is precluded by the bulky t-butyl group. The rate process is thus attributed to rotation about the Cα-CO bond (ψ) and a barrier (ΔG#) of 14kcal mol-1 is estimated. 13C n.m.r. data for pivaloyl-Pro-N-methylamide in a number of solvents is presented and the differences in the Cβ and Cγ chemical shifts are interpreted in terms of rotational isomerism about the Cα-CO bond.

Racemization at proline residues during peptide bond formation : A study of diastereomeric mixtures of synthetic alamethicin fragments by 270 MHz 1H NMR

The stepwise synthesis of amino terminal pentapeptide of alamethicin, Z-Aib-Pro-Aib-Ala-Aib-OMe, by the dicyclohexylcarbodiimide mediated couplings leads to extensive racemization at the Ala and Pro residues. Racemization is largely suppressed by the use of additives like N-hydroxysuccinimide and 1-hydroxybenzotriazole. The presence of diastereomeric peptides may be detected by the observation of additional methyl ester and benzylic methylene signals in the 270 MHz 1H NMR spectra. Unambiguous spectral assignment of the signals to the diastereomers has been carried out by the synthesis and NMR studies of the D-Ala tetra and pentapeptides. The racemization at Pro is of particular relevance in view of the reported lack of inversion at C-terminal Pro on carboxyl activation.

Expression of hyoscyamine 6 beta-hydroxylase in the root pericycle cells and accumulation of its product scopolamine in leaf and stem tissues of Datura metel L.

Hyoscyamine 60-hydroxylase (H6H: EC 1.14.11.11), a key enzyme at the terminal step of tropane alkaloid biosynthesis, converts hyoscyamine to scopolamine. The accumulation of scopolamine in different organs, in particular the aerial parts for storage, is subject to the expression of hyoscyamine 6-phydroxylase as well as its transport from the site of synthesis. To understand the molecular basis of this regulation, we have analyzed, in parallel, the relative levels of hyoscyamine and scopolamine, and the accumulation of H6H (both protein and transcript) in leaves, stems and roots of D. metel. The root, stem and leaf tissues all contain about 0.51-0.65 mg g(-1) dry weight of scopolamine. Hyoscyamine content was extremely low in leaf and stem tissues and was about 0.28 mg g(-1) dry weight in the root tissue. H6H protein and its transcript were found only in roots but not in the aerial parts viz. stems and leaves. The immunolocalization studies performed on leaf, stem, root as well as hairy root tissues showed that H6H was present only in the pericycle cells of young lateral and hairy roots. These studies suggest that the conversion of hyoscyamine to scopolamine takes place in the root pericycle cells, and the alkaloid biosynthesized in the roots gets translocated to the aerial parts in D. metel. (C) 2009 Elsevier Ireland Ltd. All rights reserved.

Accumulation of glycine in the fat body of the silkworm, bombyx mori L. [31]

INVESTIGATIONS of intestinal transport of amino-acids in the locust1,2 and silkworm3,4 have shown no evidence for active accumulation in a transport from the insect gut of amino-acids. When glycine-2-14C was administered in vivo to fifth instar larvae of the silkworm, 96 per cent of the radioactivity was incorporated into various tissues within 1 h whereas in vitro only 19 per cent of the activity was transported by the mid-gut of silkworm (unpublished work). These results suggested that continued absorption of glycine by the intestine could be aided by a facilitated diffusion mechanism in which amino-acids are rapidly removed from the site of absorption either by accumulation into other tissues or by degradation. Although the insect fat body has been assigned both accumulatory and dissimilatory roles5, the mechanism of accumulation of amino-acids has not been investigated. Our present experiments show that the silkworm fat body possesses an efficient mechanism for accumulating glycine and that both the accumulation and the release of glycine are metabolically controlled.

Analysis of short interproton distances in proline peptides as a guide in the interpretation of nuclear overhauser effects

The conformational dependence of interproton distances in model proline peptides has been investigated in order to facilitate interpretation of the results of Nuclear Overhauser Effect (NOE) studies on such peptides. For this purpose two model systems, namely, Ac-Pro-NHMe and Ac-Pro-X-NHMe have been chosen and used. In the former, short interproton distances detectable in NOE experiments permit a clear distinction between conformations with Pro ψ = -300 (helical region) and those in which ψ is around 1200 (polyproline region). For the latter, the variation of distances between the protons of methyl amide and the Pro ring have been studied by superimposing on the Ramachandran map in the (φ3, ψ3) plane. The results show that β-turns and non-β-turn conformations can be readily distinguished from NOE data and such long range NOEs should be detectable for specific non-β-turn conformations. NOEs involving Cβ and Cγ protons are particularly sensitive to the state of pyrrolidine ring puckering.

Beta-turns in nascent procollagen are sites of posttranslational enzymatic hydroxylation of proline

The selective hydroxylation of proline residues in nascent procollagen chains by prolyl hydroxylase (EC 1.14.11.2) can be understood in terms of the conformational feature of the -Pro-Gly-segments in linear peptides and globular proteins. The folded beta-turn conformation in such segments appears to be the conformational requirement for proline hydroxylation. The available data on the hydroxylation of native and synthetic substrates of prolyl hydroxylase are explained on the basis of the extent of beta-turn formation in them. Taken in conjunction with the conformational features of the hydroxyproline residue, our results bring out the conformational reason for the posttranslational proline hydroxylation which, it is proposed, leads to the "straightening" of the beta-turn segments into the linear triple-helical conformation.