21 resultados para parthenocarpic cucumber
em Indian Institute of Science - Bangalore - Índia
Resumo:
Total tRNAs isolated from chloroplasts and etioplasts of cucumber cotyledons were compared with respect toamino acid acceptance, isoacceptor distribution and extent of modification. Aminoacylation of the tRNAs with nine different amino acids studied indicated that the relative acceptor activities of chloroplast total tRNAs for four amino acids are significantly higher than etioplast total tRNAs. Two dimensional polyacrylamide gel electrophoresis(2D-PAGE) of chloroplast total tRNAs separated at least 32 spots, while approximately 41 spots were resolved from etioplast total tRNAs. Comparison of the reversed-phase chromatography (RPC-5) profiles of chloroplast and etioplast leucyl-, lysyl-, phenylalanyl-, and valyl-tRNA species showed no qualitative differences in the elution profiles. However, leucyl-, lysyl- and valyl-tRNA species showed quantitative differences in the relative amounts of the isoaccepting species present in chloroplasts and etioplasts. The analysis of modified nucleotides of total tRNAs from the two plastid types indicated that total tRNA from etioplasts was undermodified with respect to ribothymidine, isopentenyladenosine/hydroxy-isopentenyladenosine, 1 -methylguanosine and 2-o-methylguanosine. This indicates that illumination may cause de novo synthesis of chloroplast tRNAmodifying enzymes encoded for by nuclear genes leading to the formation of highly modified tRNAs in chloroplasts. Based on these results, we speculate that the observed decrease in levels of aminoacylation, variations in the relative amounts of certain isoacceptors, and differences in the electrophoretic mobilities of some extra tRNA spots in the etioplast total tRNAs as compared to chloroplast total tRNAs could be due to some partially undermodified etioplast tRNAs. Taken together, the data suggested that the light-induced transformation of etioplasts into chloroplasts is accompanied by increases in the relative levels of some functional chloroplast tRNAs by post transcriptional nucleotide modifications.
Resumo:
2,4-Dinitrophenol and paranitrophenol are two major soil pollutants which are known to be metabolized by different soil microbes. Relative phytotoxicities of these parent compounds and their metabolic transformation products to the growth of cucumber seedlings were assessed. It was evident that such microbial transformations widely occurring in the soil are effective detoxification reactions and are beneficial for the plants.
Resumo:
A purified preparation of arginine decarboxylase from Cucumis sativus seedlings displayed ornithine decarboxylase activity as well. The two decarboxylase activities associated with the single protein responded differentially to agmatine, putrescine and Pi. While agmatine was inhibitory (50 %) to arginine decarboxylase activity, ornithine decarboxylase activity was stimulated by about 3-fold by the guanido arnine. Agmatine-stimulation of ornithine decarboxylase activity was only observed at higher concentrations of the amine. Inorganic phosphate enhanced arginine decarboxylase activity (2-fold) but ornithine decarboxylase activity was largely uninfluenced. Although both arginine and ornithine decarboxylase activities were inhibited by putrescine, ornithine decarboxylase activity was profoundly curtailed even at 1 mM concentration of the diamine. The enzyme-activated irreversible inhibitor for mammalian ornithine decarboxylase, viz. α-difluoromethyl ornithine, dramatically enhanced arginine decarboxylase activity (3-4 fold), whereas ornithine decarboxylase activity was partially (50%) inhibited by this inhibitor. At substrate level concentrations, the decarboxylation of arginine was not influenced by ornithine and vice-versa. Preliminary evidence for the existence of a specific inhibitor of ornithine decarboxylase activity in the crude extracts of the plant is presented. The above results suggest that these two amino acids could be decarboxylated at two different catalytic sites on a single protein.
Resumo:
Cinnamate is the product of phenylalanine ammonialyase (PAL). This compound, a precursor of phenolics in plants, has been shown to be phytotoxic. Cinnamate inhibits PAL activity in cucumber seedlings. DL-phenylalanine has the same effect on the enzyme but does not affect growth. Actinomycin D and cycloheximide are phytotoxic and inhibit PAL. Production of a double-peg has been noticed in the seedlings, grown in the presence of actinomycin D. Light stimulates PAL activity in the seedling.
Resumo:
Among the various amines administered to excisedCucumis sativus cotyledons in short-term organ culture, agmatine (AGM) inhibited arginine decarboxylase (ADC) activity to around 50%, and putrescine was the most potent entity in this regard. Homoarginine (HARG) dramatically stimulated (3- to 4-fold) the enzyme activity. Both AGM inhibition and HARG stimulation of ADC were transient, the maximum response being elicited at 12 h of culture. Mixing experiments ruled out involvement of a macromolecular effector in the observed modulation of ADC. HARG-stimulated ADC activity was completely abolished by cycloheximide, whereas AGM-mediated inhibition was unaffected. Half-life of the enzyme did not alter on treatment with either HARG or AGM. The observed alterations in ADC activity are accompanied by change in Km of the enzyme. HARG-stimulated ADC activity is additive to that induced by benzyladenine (BA) whereas in presence of KCl, HARG failed to enhance ADC activity, thus demonstrating the overriding influence of K+ on amine metabolism.
Resumo:
The properties of the S-strain of cucumber mosaic virus (S-CMV) and the B-strain of tomato aspermy virus (B-TAV) have been studied with respect to their (i) size and sedimentation behavior, (ii) requirement of divalent metal ions for stability, (iii) sensitivity towards chloride salts and the anionic detergent sodium dodecyl sulfate, (iv) solubility in ammonium sulfate-containing buffers, and (v) pH-dependent structural transitions. The results indicate that the coat protein of B-TAV is more hydrophobic than the other well-studied strains of TAV and CMV. Circular dichroism and uv absorption studies reveal pH-dependent structural transitions, although these do not result in particle swelling. These transitions appear to alter the strength of protein-nucleic acid interactions in these viruses.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
We have determined relative levels of chloroplast leucine and tyrosine isoaccepting tRNAs and modified nucleotide contents from total tRNAs isolated from dark-grown, light-grown, N6-isopentenyladenine (i6A)-treated dark-grown and i6A-treated light-grown cucumber seedlings. Significant increases in the relative amounts of tRNA(Leu)2 and tRNA(Leu)3 were observed in the i6A-treated dark-grown seedlings compared to dark-grown, light-grown and i6A-treated light-grown seedlings. On the other hand, i6A-treated light-grown seedlings tRNA(Tyr)1 increased to 85% of total tRNAs(Tyr) from about 9% in light-grown seedlings and tRNA(Tyr)2 decreased to 15% compared with 91% in light-grown seedlings. Analysis of modified nucleotide of total tRNAs indicated that pT, pI, pm1A, pm5C, pGm, pm1G, pm2G and pm7G contents were significantly higher in the total tRNA of i6A-treated dark-grown seedlings than those from untreated dark-grown seedlings. Illumination of 8-day-old dark-grown seedlings for 12 h increased the contents of pT, pI, pGm and pm1G when compared to 8-day-old dark-grown seedlings with extended growth for 12 h in dark. On the contrary, i6A had no stimulatory effect in the contents of modified nucleotide in the light-grown seedlings.
Resumo:
The cytokinins (benzyladenine or benzyladenosine) decreased spermidine and spermine contents despite increasing putrescine content, when administered to isolated cotyledons of Cucumis sativus L. var. Guntur in organ culture. KCl decreased putrescine contents, although marginally increasing polyamine contents. The cytokinins and/or KCl augmented nucleic acid biosynthesis and accumulation, resulting in enhanced growth and differentiation of the isolated cotyledons. These observations show that polyamine accumulation and growth are not always coupled.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA- treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had not detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These date indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.
Resumo:
Total tRNA isolated from cucumber cotyledons grown in the presence of radioactive sulfur was analyzed for the occurrence of thionucleosides. The analysis revealed the presence of at least five thionucleosides which were identified as 5-methylaminomethyl-2-thiouridine (mnm5s2U), 2-methylthio-N6-isopentenyladenosine (ms2i6A), 2-methylthio-N6-hydroxyisopentenyladenosine (ms2io6A), 5-methyl-2-thiouridine (m5s2U) and N-[(9-beta-ribofuranosyl-2- methylthiopurine-2-yl)-carbamoyl]-threonine (ms2t6A). A comparison of relative amounts of these thionucleosides in the total tRNAs of dark-, and light-grown cotyledons shows that the relative amounts of ms2i6A, ms2io6A and ms2t6A remain unchanged whereas mnm5s2U increases with a concomitant decrease in the relative amounts of m5s2U after light treatment of dark-grown cotyledons.
Resumo:
A protein which binds specifically to [3H]-zeatin has been isolated from cucumber cotyledons by chromatographic techniques. Its binding to [3H]-zeatin was inhibited remarkably by the addition of non-radioactive cytokinins and the order of inhibition was zeatin > -zeatin riboside > N6-(Delta2-isopentenyl)adenine > N6-(Delta2-isopentenyl)adenosine > N6-benzyl-adenosine > kinetin riboside. This protein behaved as a soluble protein with an apparent molecular size of 43,000 daltons on gel filtration through calibrated Sephadex G-100 column. The dissociation constant, Kd, of the protein-zeatin complex was about 4 × 10–7 M.
Resumo:
Total tRNAs isolated from chloroplasts and etioplasts of cucumber cotyledons were compared with respect to amino acid acceptance, isoacceptor distribution and extent of modification. Aminoacylation of the tRNAs with nine different amino acids studied indicated that the relative acceptor activities of chloroplast total tRNAs for four amino acids are significantly higher than etioplast total tRNAs. Two dimensional polyacrylamide gel electrophoresis (2D-PAGE) of chloroplast total tRNAs separated at least 32 spots, while approximately 41 spots were resolved from etioplast total tRNAs. Comparison of the reversed-phase chromatography (RPC-5) profiles of chloroplast and etioplast leucyl-, lysyl-, phenylalanyl-, and valyl-tRNA species showed no qualitative differences in the elution profiles. However, leucyl-, lysyl- and valyl-tRNA species showed quantitative differences in the relative amounts of the isoaccepting species present in chloroplasts and etioplasts. The analysis of modified nucleotides of total tRNAs from the two plastid types indicated that total tRNA from etioplasts was undermodified with respect to ribothymidine, isopentenyladenosine/hydroxy-isopentenyladenosine, 1-methylguanosine and 2-o-methylguanosine. This indicates that illumination may cause de novo synthesis of chloroplast tRNA-modifying enzymes encoded for by nuclear genes leading to the formation of highly modified tRNAs in chloroplasts. Based on these results, we speculate that the observed decrease in levels of aminoacylation, variations in the relative amounts of certain isoacceptors, and differences in the electrophoretic mobilities of some extra tRNA spots in the etioplast total tRNAs as compared to chloroplast total tRNAs could be due to some partially undermodified etioplast tRNAs. Taken together, the data suggested that the light-induced transformation of etioplasts into chloroplasts is accompanied by increases in the relative levels of some functional chloroplast tRNAs by post transcriptional nucleotide modifications.