65 resultados para nucleotide repeat
em Indian Institute of Science - Bangalore - Índia
Resumo:
Total tRNAs isolated from chloroplasts and etioplasts of cucumber cotyledons were compared with respect toamino acid acceptance, isoacceptor distribution and extent of modification. Aminoacylation of the tRNAs with nine different amino acids studied indicated that the relative acceptor activities of chloroplast total tRNAs for four amino acids are significantly higher than etioplast total tRNAs. Two dimensional polyacrylamide gel electrophoresis(2D-PAGE) of chloroplast total tRNAs separated at least 32 spots, while approximately 41 spots were resolved from etioplast total tRNAs. Comparison of the reversed-phase chromatography (RPC-5) profiles of chloroplast and etioplast leucyl-, lysyl-, phenylalanyl-, and valyl-tRNA species showed no qualitative differences in the elution profiles. However, leucyl-, lysyl- and valyl-tRNA species showed quantitative differences in the relative amounts of the isoaccepting species present in chloroplasts and etioplasts. The analysis of modified nucleotides of total tRNAs from the two plastid types indicated that total tRNA from etioplasts was undermodified with respect to ribothymidine, isopentenyladenosine/hydroxy-isopentenyladenosine, 1 -methylguanosine and 2-o-methylguanosine. This indicates that illumination may cause de novo synthesis of chloroplast tRNAmodifying enzymes encoded for by nuclear genes leading to the formation of highly modified tRNAs in chloroplasts. Based on these results, we speculate that the observed decrease in levels of aminoacylation, variations in the relative amounts of certain isoacceptors, and differences in the electrophoretic mobilities of some extra tRNA spots in the etioplast total tRNAs as compared to chloroplast total tRNAs could be due to some partially undermodified etioplast tRNAs. Taken together, the data suggested that the light-induced transformation of etioplasts into chloroplasts is accompanied by increases in the relative levels of some functional chloroplast tRNAs by post transcriptional nucleotide modifications.
Resumo:
5-Fluorouracil (5-FU) is one of the most widely used drugs for treatment of cancers, including breast cancer that exhibits its anticancer activity by inhibiting DNA synthesis and also incorporated into DNA and RNA. The objective of this investigation was to find out the total nucleotide metabolism genes regulated by 5-FU in breast cancer cell line. The breast cancer cell line MCF-7 was treated with the drug 5-FU. To analyze the expression of genes, we have conducted the experiment using 1.7k and 19k human microarray slide and confirmed the expression of genes by semiquantitative reverse transcription-polymerase chain reaction. The expression of 44 genes involved in the nucleotide metabolism pathway was quantified. Of these 44 genes analyzed, transcription of 6 genes were upregulated and 9 genes were downregulated. Earlier studies revealed that the transcription of genes for key enzymes like thymidylate synthase, thymidinekinase, and dihydropyrimidine dehydrogenase are regulated by 5-FU. This study identified some novel genes like thioredoxin reductase, ectonucleotide triphosphate dephosphorylase, and CTP synthase are regulated by 5-FU. The data also reveal large-scale perturbation in transcription of genes not involved directly in the known mechanism of action of 5-FU.
Resumo:
A stretch of 71 nucleotides in a 1.2 kilobase pair Pst I fragment of rice DNA was identified as tRNA~ gene by hybridization and nucleotide sequence analyses. The hybridization of genomic DNA with the tRNA gene showed that there are about 10 glycine tRNA genes per diploid rice genome. The 3' and 5' internal control regions, where RNA polymerase III and transcription factors bind, were found to be present in the coding sequence. The gene was transcribed into a 4S product in an yeast cell-free extract. The substitution of 5' internal control region with analogous sequences from either M13mpl9 or M13mpl8 DNA did not affect the transcription of the gene in vitro. The changes in three highly conserved nucleotides in the consensus 5' internal control region (RGYNNARYGG; R = purine, Y = pyrimidine, N = any nucleotide) did not affect transcription showing that these nucleotides are not essential for promotion of transcription. There were two 16 base pair repeats, 'TGTTTGTTTCAGCTTA' at - 130 and - 375 positions upstream from the start of the gene. Deletion of 5' flanking sequences including the 16 base pair repeat at - 375 showed increased transcription indicating that these sequences negatively modulate the expression of the gene.
Resumo:
A ternary metal-nucleotide complex, Na2[Cu(5’-IMP)2(im)o,8(H20)l,2(H20)2h]as~ 1be2e.n4 pHr2ep0a,r ed and its structure analyzed by X-ray diffraction (5’-IMP = inosine 5’-monophos hate; im = imidazole). The complex crystallizes in space group C222, with a = 8.733 (4) A, b = 23.213 (5) A, c = 21.489 (6) 1, and Z = 4. The structure was solved by the heavy-atom method and refined by full-matrix least-squares technique on the basis of 2008 observed reflections to a final R value of 0.087. Symmetry-related 5’-IMP anions coordinate in cis geometry through the N(7) atoms of the bases. The other cis positions of the coordination plane are statistically occupied by nitrogen atoms of disordered im groups and water oxygens with occupancies 0.4 and 0.6, respectively. Water oxygens in axial positions complete the octahedral coordination of Cu(I1). The complex is isostructural with C~S-[P~(S’-IMP),(NH~)~a] m”,o del proposed for Pt(I1) binding to DNA. The base binding observed in the present case is different from the typical ”phosphate only” binding shown from earlier studies on metal-nucleotide complexes containing various other ?r-aromatic amines.
Resumo:
Conformational analysis of nucleic acids and polynucleotides is far more complex than that of proteins and polypeptides, due to five single bond rotations in addition to the sugar puckerings in the monomer. Sundaralingam1 proposed the concept of the 'rigid' nucleotides from analysis of crystal structure data, with the flexibility allowed only about the phosphodiester bonds. However, the crystal structure of deoxyguanosine-5'−phosphate2,3 indicates at gt conformation about the C-4'−C-5' bond against gg in a conformationally rigid nudeotide1. Jack et al. 4 considered the flexibility of nucleotides in tRNA about the C-4'−C-5' bond, thereby introducing the concept of 'non-rigid' ribonucleotides. Conformational flexibility of the f uranose ring in DNA and RNA and their energetics using classical and quantum chemical methods have been reported5−8. We have examined the flexibility of 3'-nucleotides. alpha, the most important of the conformational parameters defining the 3'-end of a nucleotide unit9, has a value in the range 195°−270° in all the 3'-nucleotides, dinucleoside monophosphates and higher oligomers which have been surveyed. A survey of the proposed structures of polyribonudeotides10,11 also shows the values of a to be greater than 200°. However, the structures proposed for B-DNA by Arnott and Hukins12,13 and D-DNA by Arnott et al. 14 have values of alpha of 155° and 141° respectively, much lower than the lowest observed value. The structure for B-DNA has two strong, short contacts (C-2'...OP-1 = 2.64 Å and HC-2"...OP-1 = 1.79 Å) which lead to an energetically unfavourable conformation. Hence, it is of interest to investigate whether, by allowing flexibility to the sugar moiety in the nucleotide unit, it is possible to make the structure energetically favourable. Here, conformational energy calculations were carried out to determine the range of alpha which would give rise to energetically favoured conformations with different sugar puckerings. Our analysis has shown that the theoretically obtained range is nearly the same as the preferred range in crystals, indicating the flexibility of the 3'-nucleotides.
Resumo:
The crystalline mung bean nucleotide pyrophosphatase was inhibited nonlinearly by AMP, one of the products of the reaction. The partially inactive enzyme was specifically reactivated by ADP, and V at maximal activation was the same as that of the native enzyme. ATP was a linear, noncompetitive inhibitor. The kinetic evidence suggested that ADP and ATP might not be reacting at the same site as AMP. The electrophoretic mobility of the enzyme was increased by AMP, whereas ADP and ATP were without effect. The enzyme was denatured on treatment with urea or guanidine hydrochloride. The renatured and the native enzyme had the same pH (9.4) and temperature (49 °C) optimum. The Km (0.2 mImage ) and V (3.2) of the native enzyme increased on renaturation to 1.8 mImage and 8.0, respectively. In addition, renaturation resulted in desensitization of the enzyme to inhibition by low concentrations of AMP. Renaturation did not affect the reactivation of the apoenzyme by Zn2+.
Resumo:
The crystalline mung bean nucleotide pyrophosphatase was inhibited nonlinearly by AMP, one of the products of the reaction. The partially inactive enzyme was specifically reactivated by ADP, and V at maximal activation was the same as that of the native enzyme. ATP was a linear, noncompetitive inhibitor. The kinetic evidence suggested that ADP and ATP might not be reacting at the same site as AMP. The electrophoretic mobility of the enzyme was increased by AMP, whereas ADP and ATP were without effect. The enzyme was denatured on treatment with urea or guanidine hydrochloride. The renatured and the native enzyme had the same pH (9.4) and temperature (49 °C) optimum. The Km (0.2 m ) and V (3.2) of the native enzyme increased on renaturation to 1.8 m and 8.0, respectively. In addition, renaturation resulted in desensitization of the enzyme to inhibition by low concentrations of AMP. Renaturation did not affect the reactivation of the apoenzyme by Zn2+.
Resumo:
Abstract is not available.
Resumo:
CRYSTAL structure determinations of nucleic acid fragments have shown that several of the conformational features found in the monomeric building blocks are also manifested at the nucleic acid level. Stereochemical variations between thymine and uracil nucleotides are therefore of interest as they can provide a structural basis for some of the differences between the conformations of DNA and RNA. X-ray studies have so far not shown any major dissimilarities between these two nucleotide species although the sugar ring of deoxyribonucleotides is found to possess greater flexibility than that in ribonucleotides. We report here the molecular structure of deoxyuridine-5'-phosphate (dUMP-5') which is not a common monomer unit of DNAs as it is replaced by its 5-methyl analogue deoxythymidine-5'-phosphate (dTMP-5'). The investigation was undertaken to help determine whether or not this implied a fundamental difference between the geometries of these two molecules.
Resumo:
Acta Crystallographica Section A: Foundations of Crystallography covers theoretical and fundamental aspects of the structure of matter. The journal is the prime forum for research in diffraction physics and the theory of crystallographic structure determination by diffraction methods using X-rays, neutrons and electrons. The structures include periodic and aperiodic crystals, and non-periodic disordered materials, and the corresponding Bragg, satellite and diffuse scattering, thermal motion and symmetry aspects. Spatial resolutions range from the subatomic domain in charge-density studies to nanodimensional imperfections such as dislocations and twin walls. The chemistry encompasses metals, alloys, and inorganic, organic and biological materials. Structure prediction and properties such as the theory of phase transformations are also covered.
Resumo:
The addition of AMP to the crystalline and homogeneous mung bean nucleotide pyrophosphatase [EC 3.6.1.9]altered its electrophoretic mobility. AMP was tightly bound to the enzyme and was not removed on passage through a column of Sephadex G-25 or on electrophoresis. The molecular weight of the native and AMP-modified enzymes were 65,000 and 136,000, respectively. The properties of the native enzyme such as the pH (9.4) and temperature (49 °C) optima, inhibition by EDTA, reversal of EDTA-inhibition by Zn2+ and Co2+, were not altered on dimerization by AMP. The AMP-modified enzyme had a linear time-course of reaction, unlike the native enzyme which exhibited a biphasic time-course of reaction. The AMP-modified enzyme was irreversibly denatured by urea. AMP concentrations larger than 100 μM inhibited linearly the activity of the AMP-modified enzyme. ADP and ATP inhibited the activity in a sigmoidal manner. Km and V of the native and AMP-modified enzymes were, 0.25 mImage and 0.58 mImage ; and 3.3 and 2.5, respectively.
Resumo:
A model (NADH-phenazine methosulfate-O2) formally similar to pyridine nucleotide-dependent flavoprotein hydroxylases catalyzed the hydroxylation of several aromatic compounds. The hydroxylation was maximal at acid pH and was inhibited by ovine Superoxide dismutase, suggesting that perhydroxyl radicals might be intermediates in this process. The stoichiometry of the reaction indicated that a univalent reduction of oxygen was occurring. The correlation between the concentration of semiquinone and hydroxylation, and the inhibition of hydroxylation by ethanol which inhibited semiquinone oxidation, suggested the involvement of phenazine methosulfate-semiquinone. Activation of hydroxylation by Fe3+ and Cu2+ supported the contention that univalently reduced species of oxygen was involved in hydroxylation. Catalase was without effect on the hydroxylation by the model, ruling out H2O2 as an intermediate. A reaction sequence, involving a two-electron reduction of phenazine methosulfate to reduced phenazine methosulfate followed by disproportionation with phenazine methosulfate to generate the semiquinone, was proposed. The semiquinone could donate an electron to O2 to generate O2 which could be subsequently protonated to form the perhydroxyl radical.
Resumo:
Jacalin [Artocarpus integrifolia (jack fruit) agglutinin] is made up of two types of chains, heavy and light, with M(r) values of 16,200 +/- 1200 and 2090 +/- 300 respectively (on the basis of gel-permeation chromatography under denaturing conditions). Its complete amino acid sequence was determined by manual degradation using a 4-dimethylaminoazobenzene 4'-isothiocyanate double-coupling method. Peptide fragments for sequence analysis were obtained by chemical cleavages of the heavy chain with CNBr, hydroxylamine hydrochloride and iodosobenzoic acid and enzymic cleavage with Staphylococcus aureus proteinase. The peptides were purified by a combination gel-permeation and reverse-phase chromatography. The light chains, being only 20 residues long, could be sequenced without fragmentation. Amino acid analyses and carboxypeptidase-Y-digestion C-terminal analyses of the subunits provided supportive evidence for their sequence. Computer-assisted alignment of the jacalin heavy-chain sequence failed to show sequence similarity to that of any lectin for which the complete sequence is known. Analyses of the sequence showed the presence of an internal repeat spanning residues 7-64 and 76-130. The internal repeat was found to be statistically significant.
Resumo:
The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.