Degradation of monogalactosyl diglyceride and diagalactosyl diglyceride by sheep pancreatic enzymes

1. Saline extract of sheep pancreas acetone-dried powder was shown to catalyse acyl ester hydrolysis of spinach leaf galactosyl diglycerides and also galactosylglucosyl diglyceride of Lactobacillus casei. 2. Sodium deoxycholate stimulated the enzyme activity. Ca2+ had no effect on the hydrolysis of monogalactosyl diglyceride, but it enhanced that of digalactosyl diglyceride. When added together, there was considerably less activity with both the substrates. 3. Optimal hydrolysis was observed at pH7.2. 4. The initial point of hydrolysis was at position-1, leading to the formation of monogalactosyl monoglyceride and digalactosyl monoglyceride. Further hydrolysis to the corresponding galactosylglycerols and later to galactose and glycerol was also observed, indicating the presence of a- and b-galactosidases in the enzyme preparation. 5. Formation of monogalactosyl diglyceride from digalactosyl diglyceride by the action of a-galactosidase was noted. 6. Monogalactosyl diglyceride was also hydrolysed by b-galactosidase to a limited extent, giving rise to diacylglycerol and galactose. 7. Attempts at purification of monogalactosyl diglyceride acyl hydrolase by using protamine sulphate treatment, Sephadex G-100 filtration and DEAE-cellulose chromatography gave a partially purified enzyme which showed 9- and 81-fold higher specific activity towards monogalactosyl diglyceride and digalactosyl diglyceride respectively. This still showed acyl ester hydrolysis activity towards methyl oleate, phosphatidylcholine and triacylglycerol. 8. When sheep, rat and guinea-pig tissues were compared, guinea-pig tissues showed the highest activity towards both monogalactosyl diglyceride and digalactosyl diglyceride. In all the species pancreas showed higher activity than intestine.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Cucumber chloroplast trnL(CAA) gene: nucleotide sequence and in vivo expression analysis in etiolated cucumber seedlings treated with benzyladenine and light.

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.

Cucumber chloroplast trnL(CAA) gene: nucleotide sequence and in vivo expression analysis in etiolated cucumber seedlings treated with benzyladenine and light

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA- treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had not detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These date indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.

The conversion of 3-hydroxyanthranilic acid to cinnabarinic acid by the nuclear fraction of rat liver

Although several authors have implicated 3-hydroxyanthranilic acid (3-OHA) as an intermediate in tryptophaniacin pathway in animals (Kaplan, 1961), alternative pathways of metabolism of this compound have not been fully explored. Madhusudanan Nair obtained an enzyme from spinach leaves which could convert 3-OHA to cinnabarinic acid (private communication). Viollier and Süllmann (1950) reported the conversion of 3-OHA to an unidentified red compound by rat liver homogenates. The present investigation describes the identification of this product as cinnabarinic acid (2-amino-3-H-isophenoxazine-3-one-1,9-dicarboxylic acid). Cinnabarinic acid is known to occur in nature along with cinnabarin is olated from the fungus Polystictus sanguineus (Gripenberg et al., 1957; Gripenberg, 1958).