162 resultados para Nucleotide sequence
em Indian Institute of Science - Bangalore - Índia
Resumo:
Abstract is not available.
Resumo:
The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
The complete sequence of a P4 type VP4 gene from a G2 serotype human rotavirus, IS2, isolated in India has been determined. Although the IS2 VP4 is highly homologous to the other P4 type alleles, it contained acidic amino acid substitutions at several positions that make it acidic among the P4 type alleles that are basic. Moreover, comparative sequence analysis revealed unusual polymorphism in members of the P4 type at amino acid position 393 which is highly conserved in members of other VP4 types. To date, expression of complete VP4 inE. coli has not been achieved. In this study we present successful expression inE. coli of the complete VP4 as well as VP8* and VP5* cleavage subunits in soluble form as fusion proteins of the maltose-binding protein (MBP) and their purification by single-step affinity chromatography. The hemagglutinating activity exhibited by the recombinant protein was specifically inhibited by the antiserum raised against it. Availability of pure VP4 proteins should facilitate development of polyclonal and monoclonal antibodies (MAbs) for P serotyping of rotaviruses.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA- treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had not detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These date indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.
Resumo:
Transfer RNAs of Azospirillum lipoferum were separated by two- dimensional gel electrophoresis and identified by aminoacylation. Thirty-six tRNA spots were resolved by this technique and twenty-six tRNA species have been identified. There are five tRNAs for Leu, four for Val, three for Pro, two each for Arg, Ile, Lys and Tyr, and one each for Ala, Asp, His, Phe, Ser and Thr. The tRNA(Asn) (QUU) was purified and its nucleotide sequence was determined. The A. lipoferum tRNA(Asn) (QUU) is 92% similar to B. subtilis tRNA(Asn) gene and two hypermodified nucleosides, queuosine (Q) and N-(9-beta-D Ribofuranosylpurine-6-YL) carbamoyl)-threonine (t(6)A) are present in this tRNA.
Resumo:
32P labelled 5S RNA isolated fromMycobacterium smegmatis was digested withT 1 and pancreatic ribonucleases separately and fingerprinted by two dimensional high voltage electrophoresis on thin-layer DEAE-cellulose plates. The radioactive spots were sequenced and their molar yields were determined. The chain length of the 5S RNA was found to be 120. It showed resemblances to both prokaryotic and eukaryotic 5S RNAs.
Resumo:
The 3' terminal 1255 nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3' terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addiition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.
Resumo:
The nucleotide sequence of cosmid B1790, carrying the Rif-Str regions of the Mycobacterium leprae chromosome, has been determined. Twelve open reading frames were identified in the 36716bp sequence, representing 40% of the coding capacity. Five ribosomal proteins, two elongation factors and the β and β'subunits of RNA polymerase have been characterized and two novel genes were found. One of these encodes a member of the so-called ABC family of ATP-binding proteins while the other appears to encode an enzyme involved in repairing genomic lesions caused by free radicals. This finding may well be significant as M. leprae, an intracellular pathogen, lives within macrophages.
Resumo:
NSP3, an acidic nonstructural protein, encoded by gene 7 has been implicated as the key player in the assembly of the 11 viral plus-strand RNAs into the early replication intermediates during rotavirus morphogenesis. To date, the sequence or NSP3 from only three animal rotaviruses (SA11, SA114F, and bovine UK) has been determined and that from a human strain has not been reported. To determine the genetic diversity among gene 7 alleles from group A rotaviruses, the nucleotide sequence of the NSP3 gene from 13 strains belonging to nine different G serotypes, from both humans and animals, has been determined. Based on the amino acid sequence identity as well as phylogenetic analysis, NSP3 from group A rotaviruses falls into three evolutionarily related groups, i.e., the SA11 group, the Wa group, and the S2 group. The SA 11/SA114F gene appears to have a distant ancestral origin from that of the others and codes for a polypeptide of 315 amino acids (aa) in length. NSP3 from all other group A rotaviruses is only 313 aa in length because of a 2-amino-acid deletion near the carboxy-terminus, While the SA114F gene has the longest 3' untranslated region (UTR) of 132 nucleotides, that from other strains suffered deletions of varying lengths at two positions downstream of the translational termination codon. In spite of the divergence of the nucleotide (nt) sequence in the protein coding region, a stretch of about 80 nt in the 3' UTR is highly conserved in the NSP3 gene from all the strains. This conserved sequence in the 3' UTR might play an important role in the regulation of expression of the NSP3 gene. (C) 1995 Academic Press, Inc.
Resumo:
The crystal structures of the synthetic self-complementary octamer d(G-G-T-A-T-A-C-C) and its 5-bromouracil-containing analogue have been refined to R values of 20% and 14% at resolutions of 1·8 and 2·25 Å, respectively. The molecules adopt an A-DNA type double-helical conformation, which is minimally affected by crystal forces. A detailed analysis of the structure shows a considerable influence of the nucleotide sequence on the base-pair stacking patterns. In particular, the electrostatic stacking interactions between adjacent guanine and thymine bases produce symmetric bending of the double helix and a major-groove widening. The sugar-phosphate backbone appears to be only slightly affected by the base sequence. The local variations in the base-pair orientation are brought about by correlated adjustments in the backbone torsion angles and the glycosidic orientation. Sequence-dependent conformational variations of the type observed here may contribute to the specificity of certain protein-DNA interactions.
Resumo:
Background & objectives: Periplasmic copper and zinc superoxide dismutase (Cu,Zn-SOD or SodC) is an important component of the antioxidant shield which protects bacteria from the phagocytic oxidative burst. Cu,Zn-SODs protect Gram-negative bacteria against oxygen damage which have also been shown to contribute to the pathogenicity of these bacterial species. We report the presence of SodC in drug resistant Salmonella sp. isolated from patients suffering from enteric fever. Further sodC was amplified, cloned into Escherichia coli and the nucleotide sequence and amino acid sequence homology were compared with the standard strain Salmonella Typhimurium 14028. Methods: Salmonella enterica serovar Typhi (S. Typhi) and Salmonellaenterica serovar Paratyphi (S. Paratyphi) were isolated and identified from blood samples of the patients. The isolates were screened for the presence of Cu, Zn-SOD by PAGE using KCN as inhibitor of Cu,Zn-SOD. The gene (sodC) was amplified by PCR, cloned and sequenced. The nucleotide and amino acid sequences of sodC were compared using CLUSTAL X.Results: SodC was detected in 35 per cent of the Salmonella isolates. Amplification of the genomic DNA of S. Typhi and S. Paratyphi with sodC specific primers resulted in 519 and 515 bp amplicons respectively. Single mutational difference at position 489 was observed between thesodC of S. Typhi and S. Paratyphi while they differed at 6 positions with the sodC of S. Typhimurium 14028. The SodC amino acid sequences of the two isolates were homologous but 3 amino acid difference was observed with that of standard strain S. Typhimurium 14028.Interpretation & conclusions: The presence of SodC in pathogenic bacteria could be a novel candidate as phylogenetic marker.
Resumo:
The nucleotide sequence of genes 4 and 9, encoding the outer capsid proteins VP4 and VP7 of a serotype 10 tissue culture-adapted strain, 1321, representative of asymptomatic neonatal rotaviruses isolated from neonates in Bangalore, India, were determined. Comparison of nucleotide and deduced amino acid sequences of 1321 VP4 and VP7 with previously published sequences of various serotypes revealed that both genes were highly homologous to the respective genes of serotype 10 bovine rotavirus, B223. The VP4 of 1321 represents a new human P serotype and the 1321 and related strains represent the first description of neonatal rotaviruses that appear to derive both surface proteins from an animal rotavirus.