Charge transfer complexes of crown ethers with neutral organic gyama-acceptor, 2-dicyanoethylene 1,3-indane dione

The interaction of benzo-15-crown-5, dibenzo-18-crown-6 and dibenzo-24-crown-8 with 2-dicyanoethylene 1,3-indane dione in CH2Cl2 has been described in terms of the formation of 1 : 1 molecular complexes. The magnitude of association constants and thermodynamic parameters indicate cooperative interactions of oxygens with the acceptors. The 1H and 13C NMR spectra of the complexes show that gyama-gyama interactions are a major source of ground state stabilization in these complexes.

Charge transfer in Chevrel phases

Chemical shifts of Mo K-absorption edge and Mo core level binding energies in Ax Mo6 Ch8 (Ch = S, Se, Te) Chevrel phases show clear evidence for charge transfer from the A element to the Mo6 cluster. The chemical shifts vary linearly with the intercluster Mo-Mo distance as well as the rhombohedral parameter.

Mass transfer with surface reaction in arrays of cylinders at low reynolds and high peclet numbers

Creeping flow hydrodynamics combined with diffusion boundary layer equation are solved in conjunction with free-surface cell model to obtain a solution of the problem of convective transfer with surface reaction for flow parallel to an array of cylindrical pellets at high Peclet numbers and under fast and intermediate kinetics regimes. Expressions are derived for surface concentration, boundary layer thickness, mass flux and Sherwood number in terms of Damkoehler number, Peclet number and void fraction of the array. The theoretical results are evaluated numerically.

Application of the Conjugate Gradient Method to a Problem on Minimum Time Orbit Transfer

This correspondence considers the problem of optimally controlling the thrust steering angle of an ion-propelled spaceship so as to effect a minimum time coplanar orbit transfer from the mean orbital distance of Earth to mean Martian and Venusian orbital distances. This problem has been modelled as a free terminal time-optimal control problem with unbounded control variable and with state variable equality constraints at the final time. The problem has been solved by the penalty function approach, using the conjugate gradient algorithm. In general, the optimal solution shows a significant departure from earlier work. In particular, the optimal control in the case of Earth-Mars orbit transfer, during the initial phase of the spaceship's flight, is found to be negative, resulting in the motion of the spaceship within the Earth's orbit for a significant fraction of the total optimized orbit transfer time. Such a feature exhibited by the optimal solution has not been reported at all by earlier investigators of this problem.

Laminar compressible boundary layers with vectored mass transfer

The paper studies the influence of vectored suction or injection on the flow and heat transfer at the stagnation point of a two-dimensional body (a cylinder) and an axisymmetric body (a sphere) with allowance for the effects of variable gas properties. The analysis is based on the boundary-layer equations in dimensionless form for the steady compressible fluid with variable properties in the stagnation region of a two-dimensional or an axisymmetric body with tangential and normal surface mass transfer under similarity requirements. It is shown that the variation of the density-viscosity product across the boundary layer has a strong effect on the skin friction and heat transfer. This gives rise to a point of inflection which can be removed by suction and by increasing the wall temperature. The skin friction and heat transfer are significantly affected by the pressure gradient parameter.

Velocity ratio-cum-transfer matrix method for the evaluation of a muffler with mean flow

The paper deals with a method for the evaluation of exhaust muffers with mean flow. A new set of variables, convective pressure and convective mass velocity, have been defined to replace the acoustic variables. An expression for attenuation (insertion loss) of a muffler has been proposed in terms of convective terminal impedances and a velocity ratio, on the lines of the one existing for acoustic filters. In order to evaluate the velocity ratio in terms of convective variables, transfer matrices for various muffler elements have been derived from the basic relations of energy, mass and momentum. Finally, the velocity ratiocum-transfer matrix method is illustrated for a typical straight-through muffler.

On the transfer matrix for a uniform tube with a moving medium

Abstract is not available.

Numerical study of heat transfer in laminar film boiling by the finite-difference method

The finite-difference form of the basic conservation equations in laminar film boiling have been solved by the false-transient method. By a judicious choice of the coordinate system the vapour-liquid interface is fitted to the grid system. Central differencing is used for diffusion terms, upwind differencing for convection terms, and explicit differencing for transient terms. Since an explicit method is used the time step used in the false-transient method is constrained by numerical instability. In the present problem the limits on the time step are imposed by conditions in the vapour region. On the other hand the rate of convergence of finite-difference equations is dependent on the conditions in the liquid region. The rate of convergence was accelerated by using the over-relaxation technique in the liquid region. The results obtained compare well with previous work and experimental data available in the literature.

A simple method for large-scale preparation of chick embryo tRNA

A simple method for preparing bulk quantities of tRNA from chick embryo has been developed. In this method chick embryos were homogenized in a buffer of pH 4.5, followed by deproteinization with phenol. The aqueous layer was allowed to separate under gravity. The resulting aqueous layer, after two more phenol treatments, was directly passed through a DEAE-cellulose column and the tRNA eluted therefrom with 1 Image NaCl. The tRNA prepared by this method was as active as the one prepared at neutral pH.

Laminar hypersonic boundary-layer flow at a three-dimensional stagnation point with slip and mass transfer

Abstract is not available.

Heat transfer to power-law fluids in thermal entrance region with viscous dissipation for constant heat flux conditions

An analytical solution of the heat transfer problem with viscous dissipation for non-Newtonian fluids with power-law model in the thermal entrance region of a circular pipe and two parallel plates under constant heat flux conditions is obtained using eigenvalue approach by suitably replacing one of the boundary conditions by total energy balance equation. Analytical expressions for the wall and the bulk temperatures and the local Nusselt number are presented. The results are in close agreement with those obtained by implicit finite-difference scheme. It is found that the role of viscous dissipation on heat transfer is completely different for heating and cooling conditions at the wall. The results for the case of cooling at the wall are of interest in the design of the oil pipe line.

Succinate and malate improve development of hamster eight-cell embryos in vitro: Confirmation of viability by embryo transfer

The in vitro development of hamster preimplantation embryos is supported by non-glucose energy substrates. To investigate the importance of embryonic metabolism, influence of succinate and malate on the development of hamster 8-cell embryos to blastocysts was examined using a chemically defined protein-free modified hamster embryo culture medium-2 (HECM-2m). There was a dose-dependent influence of succinate on blastocyst development; 0.5 mM succinate was optimal (85.1% ± 3.9 vs. 54.5% ± 3.5). In succinate-supplemented HECM-2m, blastocyst development was reduced by omission of lactate (68.5% ± 7.2), but not pyruvate (85.8% ± 6.2) or glutamine (84.1% ± 2.1). Succinate along with either glutamine or lactate or pyruvate poorly supported blastocyst development (28%-58%). Malate also stimulated blastocyst development; 0.01 mM malate was optimal (86.3% ± 2.8). Supplementation of both succinate and malate to HECM-2m supported maximal (100%) blastocyst development, which was inhibited 4-fold by the addition of glucose/phosphate. The mean cell numbers (MCN) of blastocysts cultured in succinate-supplemented HECM-2m was higher (28.3 ± 1.1) than it was for those cultured in the absence of glutamine or pyruvate (range 20-24). The MCN was the highest (33.4 ± 1.6) for blastocysts cultured in succinate-malate-supplemented HECM-2m followed by those in succinate (28.3 ± 1.1) or malate (24.7 ± 0.5) supplemented HECM-2m. Embryo transfer experiments showed that 29.8% (±4.5) of transferred blastocysts cultured in succinate-malate-supplemented HECM-2m produced live births, similar (P > 0.1) to the control transfers of freshly recovered 8-cells (33.5% ± 2.0) or blastocysts (28.9% ± 3.0). These data show that supplementation of succinate and malate to HECM-2m supports 100% development of hamster 8-cell embryos to high quality viable blastocysts and that non-glucose oxidizable energy substrates are the most preferred components in hamster embryo culture medium. Mol. Reprod. Dev. 47:440-447, 1997. © 1997 Wiley-Liss, Inc.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.