397 resultados para NONCODING CHLOROPLAST DNA
Resumo:
The nature of interaction of palladium(II) with calf thymus DNA was studied using viscometry, ultraviolet, visible and infrared spectrophotometry and optical rotatory disperison and circular dichroism measurements. The results indicate that Pd(II) interacts with both the phosphate and bases of DNA. The ORD/CD data indicate that the binding of Pd(II) to DNA brings about considerable conformational changes in DNA.
Resumo:
The interaction of copper-thiosemicarbazide complexes with DNA was investigated using ultraviolet and infrared spectroscopy. Evidence for the interaction of the complexes with nucleic acid bases and with the phosphate group is presented.
Resumo:
Four new ternary copper(II) complexes of alpha-amino acid having polypyridyl bases of general formulation [Cu(L-ala)(B)(H2O)](X)(1-4), where L-ala is L-alanine, B is an N,N-donor heterocyclic base, viz. 2,2'-bipyridine (bpy, 1), 1,10-phenanthroline (phen, 2) and 5,6-phenanthroline dione (dione, 3), dipyrido[3,2:2',3'-f] quinoxaline (dpq, 4), and X = ClO4-/NO3- are synthesized, characterized by various spectroscopic and X-ray crystallographic methods. The complexes show a distorted square-pyramidal (4 + 1) CuN3O2 coordination geometry. The one-electron paramagnetic complexes (1-4) display a low energy d-d band near 600 nm in aqueous medium and show a quasi-reversible cyclic voltammetric response due to one-electron Cu(II)/Cu(I) reduction near - 100 mV (versus SCE) in DMF-0.1 M TBAP. Binding interactions of the complexes with calf thymus DNA (CT-DNA) were investigated by UV-Vis absorption titration, ethidium bromide displacement assay, viscometric titration experiment and DNA melting studies. All the complexes barring the complexes 1 and 3 are avid binder to the CT-DNA in the DNA minor groove giving an order: 4 > 2 >>>1, 3. The complexes 2 and 4 show appreciable chemical nuclease activity in the presence of 3-mercaptopropionic acid (MPA) as a reducing agent. Hydroxyl radical was investigated to be the DNA cleavage active species. Control experiments in the presence of distamycin-A show primarily minor groove-binding propensity for the complexes 2 and 4 to the DNA.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
5-Fluoro-2'-deoxyuricine is incorporated into DNA of mouse breast tumour Image . The incorporation is inhibited by thymidine. Part of the fluorodeoxyuridine is cleaved to fluorouracil and is incorporated into RNA. This incorporation is enhanced by thymidine. The result suggests that the major mechanism of action of the fluorouracil is due to its incorporation into RNA. FUra, 5-Fluorouracil; FdUR, 5-Fluoro-2'-deoxyuridine; FdUMP, 5-Fluoro-2'-deoxyuridine-5'-monophosphate.
Resumo:
A probe, 9-(anthrylmethyl)trimethylammonium chloride, 1, was prepared. 1 binds to calf-thymus DNA or Escherichia coli genomic DNA with high affinity, as evidenced from the absorption titration. Strong hypochromism, spectral broadening and red-shifts in the absorption spectra were observed. Half-reciprocal plot constructed from this experiment gave binding constant of 5±0.5×104 M−1 in base molarity. We employed this anthryl probe-DNA complex for studying the effects of addition of various surfactant to DNA. Surfactants of different charge types and chain lengths were used in this study and the effects of surfactant addition to such probe-DNA complex were compared with that of small organic cations or salts. Addition of either salts or cationic surfactants led to structural changes in DNA and under these conditions, the probe from the DNA-bound complex appeared to get released. However, the cationic surfactants could induce such release of the probe from the probe-DNA complex at a much lower concentration than that of the small organic cations or salts. In contrast the anionic surfactants failed to promote any destabilization of such probe-DNA complexes. The effects of additives on the probe-DNA complexes were also examined by using a different technique (fluorescence spectroscopy) using a different probe ethidium bromide. The association complexes formed between the cationic surfactants and the plasmid DNA pTZ19R, were further examined under agarose gel electrophoresis and could not be visualized by ethidium bromide staining presumably due to cationic surfactant-induced condensation of DNA. Most of the DNA from such association complexes can be recovered by extraction of surfactants with phenol-chloroform. Inclusion of surfactants and other additives into the DNA generally enhanced the DNA melting temperatures by a few °C and at high [surfactant], the corresponding melting profiles got broadened.
Resumo:
Recognition of a specific DNA sequence by a protein is probably the best example of macromolecular interactions leading to various events. It is a prerequisite to understanding the basis of protein-DNA interactions to obtain a better insight into fundamental processes such as transcription, replication, repair, and recombination. DNA methyltransferases with varying sequence specificities provide an excellent model system for understanding the molecular mechanism of specific DNA recognition. Sequence comparison of cloned genes, along with mutational analyses and recent crystallographic studies, have clearly defined the functions of various conserved motifs. These enzymes access their target base in an elegant manner by flipping it out of the DNA double helix. The drastic protein-induced DNA distortion, first reported for HhaI DNA methyltransferase, appears to be a common mechanism employed by various proteins that need to act on bases. A remarkable feature of the catalytic mechanism of DNA (cytosine-5) methyltransferases is the ability of these enzymes to induce deamination of the target cytosine in the absence of S-adenosyl-L-methionine or its analogs. The enzyme-catalyzed deamination reaction is postulated to be the major cause of mutational hotspots at CpG islands responsible for various human genetic disorders. Methylation of adenine residues in Escherichia coli is known to regulate various processes such as transcription, replication, repair, recombination, transposition, and phage packaging.
Resumo:
A positive cis-acting DNA element in the near 5'-upstream region of the CYP2B1/B2 genes in rat liver was found to play an important role in the transcription of these genes. An oligonucleotide covering -69 to -98 nt mimicked the gel mobility shift pattern given by the fragment -179 to +29 nt, which was earlier found adequate to confer the regulatory features of this gene. Two major complexes were seen, of which the slower and faster moving complexes became intense under uninduced and Phenobarbitone-induced conditions respectively. Minigene cloned DNA plasmid covering -179 to +181 nt in pUC 19 and Bal 31 mutants derived from this parent were transcribed in whole nuclei and cell free transcription extracts and mutants containing only upto -75 nt of the upstream were poorly transcribed. Transcription extracts from phenobarbitone-injected rat liver nuclei were significantly more active than extracts from uninduced rats in transcribing the minigene constructs. Addition of the oligonucleotide (-69 to -98nt) specifically inhibited the transcription of the minigene construct (-179 to +181 nt) in the cell free transcription system. It is therefore, concluded that the region -69 to -98 nt acts as a positive cis-acting element in the transcription of the CYP2B1/B2 genes and in mediating the inductive effects of phenobarbitone.
Resumo:
Several metal complexes of three different functionalized salen derivatives have been synthesized. The salens differ in terms of the electrostatic character and the location of the charges. The interactions of such complexes with DNA were first investigated in detail by UV−vis absorption titrimetry. It appears that the DNA binding by most of these compounds is primarily due to a combination of electrostatic and other modes of interactions. The melting temperatures of DNA in the presence of various metal complexes were higher than that of the pure DNA. The presence of additional charge on the central metal ion core in the complex, however, alters the nature of binding. Bis-cationic salen complexes containing central Ni(II) or Mn(III) were found to induce DNA strand scission, especially in the presence of co-oxidant as revealed by plasmid DNA cleavage assay and also on the basis of the autoradiogram obtained from their respective high-resolution sequencing gels. Modest base selectivity was observed in the DNA cleavage reactions. Comparisons of the linearized and supercoiled forms of DNA in the metal complex-mediated cleavage reactions reveal that the supercoiled forms are more susceptible to DNA scission. Under suitable conditions, the DNA cleavage reactions can be induced either by preformed metal complexes or by in situ complexation of the ligand in the presence of the appropriate metal ion. Also revealed was the fact that the analogous complexes containing Cu(II) or Cr(III) did not effect any DNA strand scission under comparable conditions. Salens with pendant negative charges on either side of the precursor salicylaldehyde or ethylenediamine fragments did not bind with DNA. Similarly, metallosalen complexes with net anionic character also failed to induce any DNA modification activities.
Resumo:
Silk gland cells ofBombyx mori undergo chromosomal endoduplication throughout larval development. The DNA content of both posterior and middle silk gland nuclei increased by 300000 times the haploid genomic content, amounting to 18 rounds of replication. The DNA doubling time is approximately 48 h and 24 h during the fourth and fifth instars of larval development. However, DNA content does not change during the interim moult. Concomitant with DNA content, DNA polymerase activity also increases as development progressed. Enzyme activity is predominantly due to DNA polymerase with no detectable level of polymerase . DNA polymerase from silk gland extracts was purified to homogeneity (using a series of columns involving ionexchange, gel-filtration and affintiy chromatography), resulting in a 4000-fold increase in specific activity. The enzyme is a heterogeneous multimer of high molecular mass, and the catalytic (polymerase) activity is resident in the 180-kDa subunit. The enzyme shows a PI of 6.2 and theKm values for the dNTP vary over 5-16 . The polymerase is tightly associated with primase activity and initiates primer synthesis in the presence of ribonucleoside triphosphates on a single-stranded DNA template. The primase activity is resident in the 45-kDa subunit. The enzyme is devoid of any detectable exonuclease activity. The abundance of DNA polymerase α in silk glands and its strong association with the nuclear matrix suggest a role in the DNA endoduplication process.
Resumo:
The hallmark of mammalian spermiogenesis is the dramatic chromatin remodeling process wherein the nucleosomal histones are replaced by the transition proteins TP1, TP2, and TP4. Subsequently these transition proteins are replaced by the protamines P1 and P2. Hyperacetylation of histone H4 is linked to their replacement by transition proteins. Here we report that TP2 is acetylated in vivo as detected by anti-acetylated lysine antibody and mass spectrometric analysis. Further, recombinant TP2 is acetylated in vitro by acetyltransferase KAT3B (p300) more efficiently than by KAT2B (PCAF). In vivo p300 was demonstrated to acetylate TP2. p300 acetylates TP2 in its C-terminal domain, which is highly basic in nature and possesses chromatin-condensing properties. Mass spectrometric analysis showed that p300 acetylates four lysine residues in the C-terminal domain of TP2. Acetylation of TP2 by p300 leads to significant reduction in its DNA condensation property as studied by circular dichroism and atomic force microscopy analysis. TP2 also interacts with a putative histone chaperone, NPM3, wherein expression is elevated in haploid spermatids.Interestingly, acetylation of TP2 impedes its interaction with NPM3. Thus, acetylation of TP2 adds a new dimension to its role in the dynamic reorganization of chromatin during mammalian spermiogenesis.
Resumo:
Sequence specific interaction between DNA and protein molecules has been a subject of active investigation for decades now. Here, we have chosen single promoter containing bacteriophage Delta D-III T7 DNA and Escherichia coli RNA polymerase and followed their recognition at the air-water interface by using the surface plasmon resonance (SPR) technique, where the movement of one of the reacting species is restricted by way of arraying them on an immobilized support. For the Langmuir monolayer studies, we used a RNA polymerase with a histidine tag attached to one of its subunits, thus making it an xcellent substrate for Ni(II) ions, while the SPR Studies were done using biotin-labeled DNA immobilized on a streptavidin-coated chip. Detailed analysis of the thermodynamic parameters as a function of concentration and temperature revealed that the interaction of RNA polymerase with T7 DNA is largely entropy driven (83 (+/- 12) kcal mol(-1)) with a positive enthalpy of 13.6 (+/- 3.6) kcal mol(-1), The free energy of reaction determined by SPR and Langmuir-Blodgett technique was -11 (+/- 2) and -15.6 kcal mol(-1), respectively. The ability of these methods to retain the specificity of the recognition process was also established.
Resumo:
The rapid increase in genome sequence information has necessitated the annotation of their functional elements, particularly those occurring in the non-coding regions, in the genomic context. Promoter region is the key regulatory region, which enables the gene to be transcribed or repressed, but it is difficult to determine experimentally. Hence an in silico identification of promoters is crucial in order to guide experimental work and to pin point the key region that controls the transcription initiation of a gene. In this analysis, we demonstrate that while the promoter regions are in general less stable than the flanking regions, their average free energy varies depending on the GC composition of the flanking genomic sequence. We have therefore obtained a set of free energy threshold values, for genomic DNA with varying GC content and used them as generic criteria for predicting promoter regions in several microbial genomes, using an in-house developed tool `PromPredict'. On applying it to predict promoter regions corresponding to the 1144 and 612 experimentally validated TSSs in E. coli (50.8% GC) and B. subtilis (43.5% GC) sensitivity of 99% and 95% and precision values of 58% and 60%, respectively, were achieved. For the limited data set of 81 TSSs available for M. tuberculosis (65.6% GC) a sensitivity of 100% and precision of 49% was obtained.
Resumo:
Histones H1a and H1t are two major linker histone variants present at the pachytene interval of mammalian spermatogenesis. The DNA- and chromatin-condensing properties of these two variants isolated from rat testes were studied and compared with those from rat liver. For this purpose, the histone H1 subtypes were purified from the respective tissues using bath acid and salt extraction procedures, Circular dichroism studies revealed that acid exposure during isolation affects the alpha-helical structure of both the globular domain (in the presence of 1 M NaCl) and the C-terminal lambda-tail (in the presence of 60% trifluoroethanol). The condensation of rat oligonucleosomal DNA, as measured by circular dichroism spectroscopy, by the salt-extracted histone H1 was at least 10 times more efficient than condensation by the acid-extracted histone H1. A site size of 16-20 base pairs was calculated for the salt-extracted histone H1. Among the different histone H1 subtypes, somatic histone H1bdec had the highest DNA-condensing property, followed by histone H1a and histone H1t. All the salt-extracted histones condensed rat oligonucleosomal DNA more efficiently than linear pBR-322 DNA, Histones H1bdec and H1a condensed histone H1-depleted chromatin, prepared from rat liver nuclei, with relatively equal efficiency. On the other hand, there was no condensation of histone H1-depleted chromatin with the testes specific histone H1t. A comparison of the amino acid sequences of histone H1d (rat) and histone H1t (rat) revealed several interesting differences in the occurrence of DNA-binding motifs at the C-terminus. A striking observation is the presence of a direct repeat of an octapeptide motif K(A)T(S)PKKA(S)K(T)K(A) in histone H1d that is absent in histone H1t.
Resumo:
Histones H1a and H1t are two major linker histone variants present at the pachytene interval of mammalian spermatogenesis. The DNA- and chromatin-condensing properties of these two variants isolated from rat testes were studied and compared with those from rat liver. For this purpose, the histone H1 subtypes were purified from the respective tissues using bath acid and salt extraction procedures, Circular dichroism studies revealed that acid exposure during isolation affects the alpha-helical structure of both the globular domain (in the presence of 1 M NaCl) and the C-terminal lambda-tail (in the presence of 60% trifluoroethanol). The condensation of rat oligonucleosomal DNA, as measured by circular dichroism spectroscopy, by the salt-extracted histone H1 was at least 10 times more efficient than condensation by the acid-extracted histone H1. A site size of 16-20 base pairs was calculated for the salt-extracted histone H1. Among the different histone H1 subtypes, somatic histone H1bdec had the highest DNA-condensing property, followed by histone H1a and histone H1t. All the salt-extracted histones condensed rat oligonucleosomal DNA more efficiently than linear pBR-322 DNA, Histones H1bdec and H1a condensed histone H1-depleted chromatin, prepared from rat liver nuclei, with relatively equal efficiency. On the other hand, there was no condensation of histone H1-depleted chromatin with the testes specific histone H1t. A comparison of the amino acid sequences of histone H1d (rat) and histone H1t (rat) revealed several interesting differences in the occurrence of DNA-binding motifs at the C-terminus. A striking observation is the presence of a direct repeat of an octapeptide motif K(A)T(S)PKKA(S)K(T)K(A) in histone H1d that is absent in histone H1t.