248 resultados para N-terminal sequence
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.
Resumo:
VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.
Resumo:
Sesbania mosaic virus (SMV) is an isometric, ss-RNA plant virus found infecting Sesbania grandiflora plants in fields near Tirupathi, South India. The virus particles, which sediment at 116 S at pH 5.5, swell upon treatment with EDTA at pH 7.5 resulting in the reduction of the sedimentation coefficient to 108 S. SMV coat protein amino acid sequence was determined and found to have approximately 60% amino acid sequence identity with that of southern bean mosaic virus (SBMV). The amino terminal 60 residue segment, which contains a number of positively charged residues, is less well conserved between SMV and SBMV when compared to the rest of the sequence. The 3D structure of SMV was determined at 3.0 Å resolution by molecular replacement techniques using SBMV structure as the initial phasing model. The icosahedral asymmetric unit was found to contain four calcium ions occurring in inter subunit interfaces and three protein subunits, designated A, B and C. The conformation of the C subunit appears to be different from those of A and B in several segments of the polypeptide. These observations coupled with structural studies on SMV partially depleted of calcium suggest a plausible mechanisms for the initiation of the disassembly of the virus capsid.
Resumo:
The mutL gene of Neisseria gonorrhoeae has been cloned and the gene product purified. We have found that the homodimeric N. gonorrhoeae MutL (NgoL) protein displays an endonuclease activity that incises covalently closed circular DNA in the presence of Mn2+, Mg2+ or Ca2+ ions, unlike human MutL alpha which shows endonuclease activity only in the presence of Mn2+. We report in the present paper that the C-terminal domain of N. gonorrhoeae MutL (NgoL-CTD) consisting of amino acids 460-658 exhibits Mn2+-dependent endonuclease activity. Sedimentation velocity, sedimentation equilibrium and dynamic light scattering experiments show NgoL-CTD to be a dimer. The probable endonucleolytic active site is localized to a metal-binding motif, DMHAX(2)EX(4)E, and the nicking endonuclease activity is dependent on the integrity of this motif. By in vitro comparison of wild-type and it mutant NgoL-CTD protein, we show that the latter protein exhibits highly reduced endonuclease activity. We therefore suggest that the mode of excision initiation in DNA mismatch repair may be different in organisms that lack MutH protein, but have MutL proteins that harbour the D[M/Q]HAX(2)EX(4)E motif.
Resumo:
P>Multicellular development in the social amoeba Dictyostelium discoideum is triggered by starvation. It involves a series of morphogenetic movements, among them being the rising of the spore mass to the tip of the stalk. The process requires precise coordination between two distinct cell types-presumptive (pre-) spore cells and presumptive (pre-) stalk cells. Trishanku (triA) is a gene expressed in prespore cells that is required for normal morphogenesis. The triA- mutant shows pleiotropic effects that include an inability of the spore mass to go all the way to the top. We have examined the cellular behavior required for the normal ascent of the spore mass. Grafting and mixing experiments carried out with tissue fragments and cells show that the upper cup, a tissue that derives from prestalk cells and anterior-like cells (ALCs), does not develop properly in a triA- background. A mutant upper cup is unable to lift the spore mass to the top of the fruiting body, likely due to defective intercellular adhesion. If wild-type upper cup function is provided by prestalk and ALCs, trishanku spores ascend all the way. Conversely, Ax2 spores fail to do so in chimeras in which the upper cup is largely made up of mutant cells. Besides proving that under these conditions the wild-type phenotype of the upper cup is necessary and sufficient for terminal morphogenesis in D. discoideum, this study provides novel insights into developmental and evolutionary aspects of morphogenesis in general. Genes that are active exclusively in one cell type can elicit behavior in a second cell type that enhances the reproductive fitness of the first cell type, thereby showing that morphogenesis is a cooperative process.
Resumo:
Sequence specific interaction between DNA and protein molecules has been a subject of active investigation for decades now. Here, we have chosen single promoter containing bacteriophage Delta D-III T7 DNA and Escherichia coli RNA polymerase and followed their recognition at the air-water interface by using the surface plasmon resonance (SPR) technique, where the movement of one of the reacting species is restricted by way of arraying them on an immobilized support. For the Langmuir monolayer studies, we used a RNA polymerase with a histidine tag attached to one of its subunits, thus making it an xcellent substrate for Ni(II) ions, while the SPR Studies were done using biotin-labeled DNA immobilized on a streptavidin-coated chip. Detailed analysis of the thermodynamic parameters as a function of concentration and temperature revealed that the interaction of RNA polymerase with T7 DNA is largely entropy driven (83 (+/- 12) kcal mol(-1)) with a positive enthalpy of 13.6 (+/- 3.6) kcal mol(-1), The free energy of reaction determined by SPR and Langmuir-Blodgett technique was -11 (+/- 2) and -15.6 kcal mol(-1), respectively. The ability of these methods to retain the specificity of the recognition process was also established.
Resumo:
An isolated wind power generation scheme using slip ring induction machine (SRIM) is proposed. The proposed scheme maintains constant load voltage and frequency irrespective of the wind speed or load variation. The power circuit consists of two back-to-back connected inverters with a common dc link, where one inverter is directly connected to the rotor side of SRIM and the other inverter is connected to the stator side of the SRIM through LC filter. Developing a negative sequence compensation method to ensure that, even under the presence of unbalanced load, the generator experiences almost balanced three-phase current and most of the unbalanced current is directed through the stator side converter is the focus here. The SRIM controller varies the speed of the generator with variation in the wind speed to extract maximum power. The difference of the generated power and the load power is either stored in or extracted from a battery bank, which is interfaced to the common dc link through a multiphase bidirectional fly-back dc-dc converter. The SRIM control scheme, maximum power point extraction algorithm and the fly-back converter topology are incorporated from available literature. The proposed scheme is both simulated and experimentally verified.
Resumo:
In recent years, identification of sequence patterns has been given immense importance to understand better their significance with respect to genomic organization and evolutionary processes. To this end, an algorithm has been derived to identify all similar sequence repeats present in a protein sequence. The proposed algorithm is useful to correlate the three-dimensional structure of various similar sequence repeats available in the Protein Data Bank against the same sequence repeats present in other databases like SWISS-PROT, PIR and Genome databases.
Pi-turns in proteins and peptides: Classification, conformation, occurrence, hydration and sequence.
Resumo:
The i + 5-->i hydrogen bonded turn conformation (pi-turn) with the fifth residue adopting alpha L conformation is frequently found at the C-terminus of helices in proteins and hence is speculated to be a "helix termination signal." An analysis of the occurrence of i + 5-->i hydrogen bonded turn conformation at any general position in proteins (not specifically at the helix C-terminus), using coordinates of 228 protein crystal structures determined by X-ray crystallography to better than 2.5 A resolution is reported in this paper. Of 486 detected pi-turn conformations, 367 have the (i + 4)th residue in alpha L conformation, generally occurring at the C-terminus of alpha-helices, consistent with previous observations. However, a significant number (111) of pi-turn conformations occur with (i + 4)th residue in alpha R conformation also, generally occurring in alpha-helices as distortions either at the terminii or at the middle, a novel finding. These two sets of pi-turn conformations are referred to by the names pi alpha L and pi alpha R-turns, respectively, depending upon whether the (i + 4)th residue adopts alpha L or alpha R conformations. Four pi-turns, named pi alpha L'-turns, were noticed to be mirror images of pi alpha L-turns, and four more pi-turns, which have the (i + 4)th residue in beta conformation and denoted as pi beta-turns, occur as a part of hairpin bend connecting twisted beta-strands. Consecutive pi-turns occur, but only with pi alpha R-turns. The preference for amino acid residues is different in pi alpha L and pi alpha R-turns. However, both show a preference for Pro after the C-termini. Hydrophilic residues are preferred at positions i + 1, i + 2, and i + 3 of pi alpha L-turns, whereas positions i and i + 5 prefer hydrophobic residues. Residue i + 4 in pi alpha L-turns is mainly Gly and less often Asn. Although pi alpha R-turns generally occur as distortions in helices, their amino acid preference is different from that of helices. Poor helix formers, such as His, Tyr, and Asn, also were found to be preferred for pi alpha R-turns, whereas good helix former Ala is not preferred. pi-Turns in peptides provide a picture of the pi-turn at atomic resolution. Only nine peptide-based pi-turns are reported so far, and all of them belong to pi alpha L-turn type with an achiral residue in position i + 4. The results are of importance for structure prediction, modeling, and de novo design of proteins.
Resumo:
The complete sequence of a P4 type VP4 gene from a G2 serotype human rotavirus, IS2, isolated in India has been determined. Although the IS2 VP4 is highly homologous to the other P4 type alleles, it contained acidic amino acid substitutions at several positions that make it acidic among the P4 type alleles that are basic. Moreover, comparative sequence analysis revealed unusual polymorphism in members of the P4 type at amino acid position 393 which is highly conserved in members of other VP4 types. To date, expression of complete VP4 inE. coli has not been achieved. In this study we present successful expression inE. coli of the complete VP4 as well as VP8* and VP5* cleavage subunits in soluble form as fusion proteins of the maltose-binding protein (MBP) and their purification by single-step affinity chromatography. The hemagglutinating activity exhibited by the recombinant protein was specifically inhibited by the antiserum raised against it. Availability of pure VP4 proteins should facilitate development of polyclonal and monoclonal antibodies (MAbs) for P serotyping of rotaviruses.
Resumo:
Software packages NUPARM and NUCGEN, are described, which can be used to understand sequence directed structural variations in nucleic acids, by analysis and generation of non-uniform structures. A set of local inter basepair parameters (viz. tilt, roll, twist, shift, slide and rise) have been defined, which use geometry and coordinates of two successive basepairs only and can be used to generate polymeric structures with varying geometries for each of the 16 possible dinucleotide steps. Intra basepair parameters, propeller, buckle, opening and the C6...C8 distance can also be varied, if required, while the sugar phosphate backbone atoms are fixed in some standard conformation ill each of the nucleotides. NUPARM can be used to analyse both DNA and RNA structures, with single as well as double stranded helices. The NUCGEN software generates double helical models with the backbone fixed in B-form DNA, but with appropriate modifications in the input data, it can also generate A-form DNA ar rd RNA duplex structures.
Resumo:
We examined whether C-terminal residues of soluble recombinant FtsZ of Mycobacterium tuberculosis (MtFtsZ) have any role in MtFtsZ polymerization in vitro. MtFtsZ-delta C1, which lacks C-terminal extreme Arg residue (underlined in the C-terminal extreme stretch of 13 residues, DDDDVDVPPFMRR), but retaining the penultimate Arg residue (DDDDVDVPPFMR), polymerizes like full-length MtFtsZ in vitro. However, MtFtsZ-delta C2 that lacks both the Arg residues at the C-terminus (DDDDVDVPPFM), neither polymerizes at pH 6.5 nor forms even single- or double-stranded filaments at pH 7.7 in the presence of 10 mM CaCl2. Neither replacement of the penultimate Arg residue, in the C-terminal Arg deletion mutant DDDDVDVPPFMR, with Lys or His or Ala or Asp (DDDDVDVPPFMK/H/A/D) enabled polymerization. Although MtFtsZ-delta C2 showed secondary and tertiary structural changes, which might have affected polymerization, GTPase activity of MtFtsZ-delta C2 was comparable to that of MtFtsZ. These data suggest that MtFtsZ requires an Arg residue as the extreme C-terminal residue for polymerization in vitro. The polypeptide segment containing C-terminal 67 residues, whose coordinates were absent from MtFtsZ crystal structure, was modeled on tubulin and MtFtsZ dimers. Possibilities for the influence of the C-terminal Arg residues on the stability of the dimer and thereby on MtFtsZ polymerization have been discussed.
Resumo:
The structural basis for the homotropic inhibition of pantothenate synthetase by the substrate pantoate was investigated by X-ray crystallography and high-resolution NMR spectroscopic methods. The tertiary structure of the dimeric N-terminal domain of Escherichia coli pantothenate synthetase, determined by X-ray crystallography to a resolution of 1.7 Å, showed a second molecule of pantoate bound in the ATP-binding pocket. Pantoate binding to the ATP-binding site induced large changes in structure, mainly for backbone and side chain atoms of residues in the ATP binding HXGH(34–37) motif. Sequence-specific NMR resonance assignments and solution secondary structure of the dimeric N-terminal domain, obtained using samples enriched in 2H, 13C, and 15N, indicated that the secondary structural elements were conserved in solution. Nitrogen-15 edited two-dimensional solution NMR chemical shift mapping experiments revealed that pantoate, at 10 mm, bound at these two independent sites. The solution NMR studies unambiguously demonstrated that ATP stoichiometrically displaced pantoate from the ATP-binding site. All NMR and X-ray studies were conducted at substrate concentrations used for enzymatic characterization of pantothenate synthetase from different sources [Jonczyk R & Genschel U (2006) J Biol Chem 281, 37435–37446]. As pantoate binding to its canonical site is structurally conserved, these results demonstrate that the observed homotropic effects of pantoate on pantothenate biosynthesis are caused by competitive binding of this substrate to the ATP-binding site. The results presented here have implications for the design and development of potential antibacterial and herbicidal agents.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.