Studies on nucleotidases in plants - Reversible denaturation of the crystalline mung bean nucleotide pyrophosphatase and the effect of adenylates on the native and renatured enzyme

The crystalline mung bean nucleotide pyrophosphatase was inhibited nonlinearly by AMP, one of the products of the reaction. The partially inactive enzyme was specifically reactivated by ADP, and V at maximal activation was the same as that of the native enzyme. ATP was a linear, noncompetitive inhibitor. The kinetic evidence suggested that ADP and ATP might not be reacting at the same site as AMP. The electrophoretic mobility of the enzyme was increased by AMP, whereas ADP and ATP were without effect. The enzyme was denatured on treatment with urea or guanidine hydrochloride. The renatured and the native enzyme had the same pH (9.4) and temperature (49 °C) optimum. The Km (0.2 m ) and V (3.2) of the native enzyme increased on renaturation to 1.8 m and 8.0, respectively. In addition, renaturation resulted in desensitization of the enzyme to inhibition by low concentrations of AMP. Renaturation did not affect the reactivation of the apoenzyme by Zn2+.

Nucleotide sequence of initiator tRNA from Mycobacterium smegmatis

Abstract is not available.

An uncommon nucleotide conformation shown by molecular structure of deoxyuridine-5-phosphate and nucleic acid stereochemistry

CRYSTAL structure determinations of nucleic acid fragments have shown that several of the conformational features found in the monomeric building blocks are also manifested at the nucleic acid level. Stereochemical variations between thymine and uracil nucleotides are therefore of interest as they can provide a structural basis for some of the differences between the conformations of DNA and RNA. X-ray studies have so far not shown any major dissimilarities between these two nucleotide species although the sugar ring of deoxyribonucleotides is found to possess greater flexibility than that in ribonucleotides. We report here the molecular structure of deoxyuridine-5'-phosphate (dUMP-5') which is not a common monomer unit of DNAs as it is replaced by its 5-methyl analogue deoxythymidine-5'-phosphate (dTMP-5'). The investigation was undertaken to help determine whether or not this implied a fundamental difference between the geometries of these two molecules.

Structure and Conformation of a Cyclic Tripeptide

MANY cyclic peptides have interesting biological functions and the details of their molecular structure and conformation have been the subject of extensive investigations. Cyclic dipeptides such as diketopiperazine have been synthesised and shown to occur with the peptide units in the cis configuration1,2. In the case of a tripeptide, cyclisation can take place only if all three units are in the cis configuration3. In cyclic peptides with four units also, cis peptides are found4,5. As the number of the peptide units increases, the more stable trans configuration is generally more common6,7. We report here the main results of our X-ray crystallographic investigations of the cyclic tripeptides L-Pro-L-Pro-L-Pro and L-Pro-L-Pro-L-Hyp (hereafter called CTP 1 and CTP 2, respectively). CTP 1 was synthesised by Rothe et al. 8 and its derivatives have been prepared by Blout and his collaborators9.

Crystal structure from packing studies: application to the triclinic structure of the cyclic hexapeptide cyclo-(gly-tyr-gly)2

The paper describes a novel method of finding the position and orientation of a relatively rigid molecule in the unit cell from criteria concerning allowed contact distances between atoms. On application to the crystal structure of a hexapeptide, C25H31N6O8.2H2O, it was possible to solve the structure from this starting point, by a series of SFLS refinements with an increasingly larger number of reflexions at successive stages. The packing analysis succeeded, even though the water molecules were not included to start with.

Sodium-ammonia reduction of some cyclic vinyl bromides

Abstract is not available.

Equivalent rate 1/2 quasi-cyclic codes

Chen et al. [1] give a list of quasi-cyclic (2m,m) codes which have the largest minimum distance of any quasi-cyclic code, for various values ofm. We present the weight distribution of these codes. It will be seen that many of the codes found by Chen et al. [1] are equivalent in the sense of having identical weight distributions.

Neutron-diffraction study of structure and conformation of nucleotide uridine-5 phosphate (disodium salt)

Acta Crystallographica Section A: Foundations of Crystallography covers theoretical and fundamental aspects of the structure of matter. The journal is the prime forum for research in diffraction physics and the theory of crystallographic structure determination by diffraction methods using X-rays, neutrons and electrons. The structures include periodic and aperiodic crystals, and non-periodic disordered materials, and the corresponding Bragg, satellite and diffuse scattering, thermal motion and symmetry aspects. Spatial resolutions range from the subatomic domain in charge-density studies to nanodimensional imperfections such as dislocations and twin walls. The chemistry encompasses metals, alloys, and inorganic, organic and biological materials. Structure prediction and properties such as the theory of phase transformations are also covered.

Sterochemical studies on cyclic peptides-VIII. Conformational analysis of hydrogen bonded cyclohexaglycyl molecule with a centre of inversion symmetry

A study on the conformational aspects of cyclo-hexaglycyl having inversion symmetry has been made. The cyclic backbone has been assumed to have two internal 4→1 types of NH... O hydrogen bonds. This molecule has been found to take up two types of conformations designated asA* andB* having nearly the same energy values. The theoretical conformations have been compared with the conformations of cyclohexaglycyl hemihydrate observed in the crystal structure. Two molecules with an approximate inversion symmetry are close to the conformation of the typeB* and two other molecules with exact inversino symmetry correspond nearly to the typesB* andA*. comparison with the theoretically possible conformations of cyclohexaglycyl molecule with 2-fold symmetry has been made. The preference of inversion symmetry and preferred ranges ofψ for glycyl molecules is discussed.

Crystal structure and conformation of the cyclic dipeptide cyclo-(L-histidyl-L-aspartyl) trihydrate

The crystal structure of cyclo-(L-histidyl-L-aspartyl) trihydrate has been determined by x-ray diffraction techniques, and refined to a final R index of 0.056 for 1601 reflections. The molecule is in a folded conformation, with the imidazole ring facing the diketopiperazine ring. However, since the diketopiperazine ring is essentially planar, the interaction between the two rings is not as intimate as in those cyclic dipeptides in which the diketopiperazine ring is in a boat conformation with the side chain occupying an axial, or flagpole, site. Planarity of the diketopiperazine ring may be dictated by steric interactions between the imidazole ring and the aspartyl side chain. The molecule is a zwitterion, a proton having been transferred from the carboxyl group of the aspartyl side chain to the imidazole ring.

Studies on nucleotidases in plants Dimerization of the crystalline mung bean nucleotide pyrophosphatase by 5-adenosine monophosphate and the properties of the dimerized enzyme

The addition of AMP to the crystalline and homogeneous mung bean nucleotide pyrophosphatase [EC 3.6.1.9]altered its electrophoretic mobility. AMP was tightly bound to the enzyme and was not removed on passage through a column of Sephadex G-25 or on electrophoresis. The molecular weight of the native and AMP-modified enzymes were 65,000 and 136,000, respectively. The properties of the native enzyme such as the pH (9.4) and temperature (49 °C) optima, inhibition by EDTA, reversal of EDTA-inhibition by Zn2+ and Co2+, were not altered on dimerization by AMP. The AMP-modified enzyme had a linear time-course of reaction, unlike the native enzyme which exhibited a biphasic time-course of reaction. The AMP-modified enzyme was irreversibly denatured by urea. AMP concentrations larger than 100 μM inhibited linearly the activity of the AMP-modified enzyme. ADP and ATP inhibited the activity in a sigmoidal manner. Km and V of the native and AMP-modified enzymes were, 0.25 mImage and 0.58 mImage ; and 3.3 and 2.5, respectively.

Mechanism of aromatic hydroxylation *1, , *2, , *3: Properties of a model for pyridine nucleotide-dependent flavoprotein hydroxylases

A model (NADH-phenazine methosulfate-O2) formally similar to pyridine nucleotide-dependent flavoprotein hydroxylases catalyzed the hydroxylation of several aromatic compounds. The hydroxylation was maximal at acid pH and was inhibited by ovine Superoxide dismutase, suggesting that perhydroxyl radicals might be intermediates in this process. The stoichiometry of the reaction indicated that a univalent reduction of oxygen was occurring. The correlation between the concentration of semiquinone and hydroxylation, and the inhibition of hydroxylation by ethanol which inhibited semiquinone oxidation, suggested the involvement of phenazine methosulfate-semiquinone. Activation of hydroxylation by Fe3+ and Cu2+ supported the contention that univalently reduced species of oxygen was involved in hydroxylation. Catalase was without effect on the hydroxylation by the model, ruling out H2O2 as an intermediate. A reaction sequence, involving a two-electron reduction of phenazine methosulfate to reduced phenazine methosulfate followed by disproportionation with phenazine methosulfate to generate the semiquinone, was proposed. The semiquinone could donate an electron to O2 to generate O2 which could be subsequently protonated to form the perhydroxyl radical.

Conformational studies on cyclic dipeptides

An analysis of 11 crystal structures of cyclic dipeptides so far reported in the literature is made, with main reference to the internal parameters of these molecules. Preferred conformations of the side chains of cyclic dipeptides with different α-amino acid residues have been studied by classical energy calculations. The possible conformations of the DKP ring are also studied. The significance of the non-bonded interaction in deciding the pathway for conformational change has also been investigated. The agreement between theoretical results and experimental observations is quite good, both with respect to the conformation of these molecules as well as the enthalpy difference as estimated from n.m.r. studies between different conformers.

Nucleotide sequence of the 3' terminal region of belladonna mottle virus-Iowa (renamed Physalis mottle virus) RNA and an analysis of the relationships of tymoviral coat proteins

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.