68 resultados para BEAN


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Here, we show the binding results of a leguminosae lectin, winged bean basic agglutinin (WBA I) to N-trifluoroacetylgalactosamine (NTFAGalN), methyl-alpha-N-trifluoroacetylgalactosamine (Me alpha NTFAGalN) and methyl-beta-tifluoroacetylgalactosamine (Me beta NTFAGalN) using (19) F NMR spectroscopy. No chemical shift difference between the free and bound states for NTFAGalN and Me beta NTFAGalN, and 0.01-ppm chemical shift change for Me alpha NTFAGalN, demonstrate that the Me alpha NTFAGalN has a sufficiently long residence time on the protein binding site as compared to Me beta NTFAGalN and the free anomers of NTFAGalN. The sugar anomers were found in slow exchange with the binding site of agglutinin. Consequently, we obtained their binding parameters to the protein using line shape analyses. Aforementioned analyses of the activation parameters for the interactions of these saccharides indicate that the binding of alpha and beta anomers of NTFAGalN and Me alpha NTFAGalN is controlled enthalpically, while that of Me beta NTFAGalN is controlled entropically. This asserts the sterically constrained nature of the interaction of the Me beta NTFAGalN with WBA I. These studies thus highlight a significant role of the conformation of the monosaccharide ligands for their recognition by WBA I.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The genomic sequences of several RNA plant viruses including cucumber mosaic virus, brome mosaic virus, alfalfa mosaic virus and tobacco mosaic virus have become available recently. The former two viruses are icosahedral while the latter two are bullet and rod shaped, respectively in particle morphology. The non-structural 3a proteins of cucumber mosaic virus and brome mosaic virus have an amino acid sequence homology of 35% and hence are evolutionarily related. In contrast, the coat proteins exhibit little homology, although the circular dichroism spectrum of these viruses are similar. The non-coding regions of the genome also exhibit variable but extensive homology. Comparison of the brome mosaic virus and alfalfa mosaic virus sequences reveals that they are probably related although with a much larger evolutionary distance. The polypeptide folds of the coat protein of three biologically distinct isometric plant viruses, tomato bushy stunt virus, southern bean mosaic virus and satellite tobacco necrosis virus have been shown to display a striking resemblance. All of them consist of a topologically similar 8-standard β-barrel. The implications of these studies to the understanding of the evolution of plant viruses will be discussed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The field bean (Dolichos lab lab ; Tamil name, Mochai ; Kanarese, Avarai) is a legume which is widely cultivated in South India often as a mixed crop with cereals. The kernel of the seed enters into the diet of may South Indian households, and in the Mysore State the seed are used as a delicacy when they are green for over four months in the year. The haulm, husk and pods are commonly used a fodder. As the kernel which is widely used as an article of food and considered to be very nutritious, contains about 24% of protein hitherto uninvestigated and as the quality of protein plays an important role in nutrition, the present work was undertaken.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Molecular oxygen (012) i8 eatabliehed to be a good electrophile' and haabean Pound to yield many interesting moleculae upon reaction with olefinic, aromatic and other mu1 tipla bonded compounda. Although, oxidation of carbon ulphur double bond (thiones) by air her bean know for a longtime, nai the r the aechaniam nor the reactive species involved in theae oxidationa have bean etabliahodo Although there is no clear experimental verification, involvement of malecular oxygen in such types of oxidationa oP activated thiocarbonyl coc pounds has been recently auggeetad.4.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Sesbania mosaic virus (SMV) is an isometric, ss-RNA plant virus found infecting Sesbania grandiflora plants in fields near Tirupathi, South India. The virus particles, which sediment at 116 S at pH 5.5, swell upon treatment with EDTA at pH 7.5 resulting in the reduction of the sedimentation coefficient to 108 S. SMV coat protein amino acid sequence was determined and found to have approximately 60% amino acid sequence identity with that of southern bean mosaic virus (SBMV). The amino terminal 60 residue segment, which contains a number of positively charged residues, is less well conserved between SMV and SBMV when compared to the rest of the sequence. The 3D structure of SMV was determined at 3.0 Å resolution by molecular replacement techniques using SBMV structure as the initial phasing model. The icosahedral asymmetric unit was found to contain four calcium ions occurring in inter subunit interfaces and three protein subunits, designated A, B and C. The conformation of the C subunit appears to be different from those of A and B in several segments of the polypeptide. These observations coupled with structural studies on SMV partially depleted of calcium suggest a plausible mechanisms for the initiation of the disassembly of the virus capsid.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA- treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had not detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These date indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The relative amounts of chloroplast tRNAs(Leu), tRNA(Glu), tRNA(Phe), tRNAs(Thr), and tRNA(Tyr) and of chloroplastic and cytoplasmic aminoacyl-tRNA synthetases were compared in green leaves, yellowing senescing leaves, and N(6)-benzyladenine-treated senescing leaves from bean (Phaseolus vulgaris, var Contender). Aminoacylation of the tRNAs using Escherichia coli aminoacyl-tRNA synthetases indicated that in senescing leaves the relative amount of chloroplast tRNA(Phe) was significantly lower than in green leaves. Senescing leaves treated with N(6)-benzyladenine contained higher levels of this tRNA than untreated senescing leaves. No significant change in the relative amounts of chloroplast tRNAs(Leu), tRNAs(Thr), and tRNA(Tyr) was detected in green, yellow senescing, or N(6)-benzyladine-treated senescing leaves. Relative levels of chloroplast tRNAs were also estimated by hybridization of tRNAs to DNA blots of gene specific probes. These experiments confirmed the results obtained by aminoacylation and revealed in addition that the relative level of chloroplast tRNA(Glu) is higher in senescing leaves than in green leaves. Transcription run-on assays indicated that these changes in tRNA levels are likely to be due to a differential rate of degradation rather than to a differential rate of transcription of the tRNA genes. Chloroplastic and cytoplasmic leucyl-, phenylalanyl-, and tyrosyl-tRNA synthetase activities were greatly reduced in senescing leaves as compared to green leaves, whereas N(6)-benzyladenine-treated senescing leaves contained higher enzyme activities than untreated senescing leaves. These results suggest that during senescence, as well as during senescence-retardation by cytokinins, changes in enzyme activities, such as aminoacyl-tRNA synthetases, rather than reduced levels of tRNAs, affect the translational capacity of chloroplasts.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A facile, one-pot synthesis of thio and selenourea derivatives from amines using tetrathiomolybdate 1 and tetraseleno-tungstate 2 as sulfur and selenium transfer reagents, respectively, is reported. The compounds were tested for their activity as urease inhibitors and some of the compounds showed potent activity in the nanomolar range towards jack bean urease. (C) 2007 Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

series of thiosugar derivatives (thiolevomannosans) derived from mannose were synthesized and their inhibitory activity was tested against alpha-mannosidase (jack bean). These inhibitors were found to be more potent than the well-known inhibitors like kifunensine and deoxymannojirimycin based on docking and biochemical studies. The sulfone derivative 10 was shown to be the best inhibitor of alpha-mannosidase with the K-i value of 350 nM. (c) 2007 Elsevier Ltd. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Lectins (phytohaemagglutinin) are known to have the unique property of binding with certain specific sugars, polysaccharides and glycoproteins. Although the kinetics of interaction between lectins and sugar have been extensively studied, the binding characteristics of the lectins with various glycoproteins are not well understood. In this laboratory a systematic study has been initiated in relation to the interaction of lectins with glycoproteins. Concanavalin A is known to bind alpha-glucosides, mannosides and biopolymers having these sugar configurations. A galactose binding protein from caster bean has been purified to homogeneity and was found to contain mannose. This lectin was used as the source of glycoprotein for studying its interaction with concanavalin A. This study showed that the interaction is temperature dependent and the dissociation is time and alpha-methyl glucoside concentration dependent. This has led to speculate a model for cell-lectin interaction. Using concanavalin A it has been shown that all the lysosomal enzymes from brain studied were glycoprotein in nature. Moreover, using Sepharose-bound concanavalin A it has been possible to devise a method by which these lysosomal enzymes could be purified considerably. With the knowledge that the interaction between lectin and glycoprotein is not only dependent on the specific sugar present in the glycoprotein, but also on the nature of the glycoprotein it was possible to develop a novel method for immobilizing various glycoprotein enzymes, such as arylsulphatase A, hyaluronidase and glucose oxidase.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The highly purified enzyme from mung bean seedlings hydrolyzing FAD at pH 9.4 and temperature 49 °, functioned with an initial fast rate followed by a second slower rate. The activity was linear with enzyme concentration over a small range of concentration and was dependent on the time of incubation. Inhibition of enzyme activity with increasing concentrations of AMP was sigmoid;concentrations less than 1 × 10−6 M were without effect, concentrations between 1 × 10−6 and 8 × 10−5 M inhibited by 20% and concentrations beyond 8 × 10−5 Image caused progressive inhibition. Concentrations beyond 1 × 10−3 Image inhibited the activity completely. Preincubation of the enzyme with PCMB or NEM, or aging, or reversible denaturation with urea abolished the inhibitory effect of AMP at concentrations lower than 8 × 10−6 Image . The aged enzyme could be reactivated by ADP.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fluorescence and stopped-flow spectrophotometric studies on three plant lectins fromPsophocarpus tetragonolobus (winged bean),Glycine max (soybean) andArtocarpus integrifolia (jack fruit) have been studied usingN-dansylgalactosamine as a fluorescent ligand. The best monosaccharide for the winged bean agglutinin I (WBA I) and soybean (SBA) is Me-agrGalNAc and for jack fruit agglutinin (JFA) is Me-agrGal. Examination of the percentage enhancement and association constants (1.51×106, 6.56×106 and 4.17×105 M–1 for SBA, WBA I and JFA, respectively) suggests that the combining regions of the lectins SBA and WBA I are apolar whereas that of JFA is polar. Thermodynamic parameters obtained for the binding of several monosaccharides to these lectins are enthalpically favourable. The binding of monosaccharides to these lectins suggests that the-OH groups at C-1, C-2, C-4 and C-6 in thed-galactose configuration are important loci for interaction with these lectins. An important finding is that the JFA binds specifically to Galß1-3GaINAc with much higher affinity than the other disaccharides which are structurally and topographically similar.The results of stopped-flow spectrometry on the binding ofN-dansylgalactosamine to these lectins are consistent with a bimolecular single step mechanism. The association rate constants (2.4×105, 1.3×104, and 11.7×105 M–1 sec–1 for SBA, WBA I and JFA, respectively) obtained are several orders of magnitude slower than the ones expected for diffusion controlled reactions. The dissociation rate constants (0.2, 3.2×10–2, 83.3 sec–1 for SBA, WBA I and JFA, respectively) obtained for the dissociation ofN-dansylgalactosamine from its lectin complex are slowest for SBA and WBA I when compared with any other lectin-ligand dissociation process.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Indole butyric acid (IBA) initiates roots in the hypocotyl tissue of Phaseolus vulgaris (French bean). The response is dependent on the concentration of IBA and the duration of exposure to the hormone. IBA enhances the rate of total protein synthesis in ca 30 min after exposure of the hypocotyl segments to the hormone. There is no detectable change in total or poly(A)-containing RNA synthesis in this period although significant increases are seen 2 hr after hormone pre-treatment. The early IBA-mediated increase in protein synthesis (30 min) is not sensitive to Actinomycin D but the antibiotic blocks the increase manifested 2 hr after hormone pre-treatment. Inhibition of early protein synthesis by cycloheximide depresses and delays root initiation. Cytosol prepared from IBA-treated hypocotyl tissue stimulates protein synthesis in vitro to a greater extent than that of the control.