103 resultados para adenine-nucleotide concentrations
Resumo:
The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
We have determined relative levels of chloroplast leucine and tyrosine isoaccepting tRNAs and modified nucleotide contents from total tRNAs isolated from dark-grown, light-grown, N6-isopentenyladenine (i6A)-treated dark-grown and i6A-treated light-grown cucumber seedlings. Significant increases in the relative amounts of tRNA(Leu)2 and tRNA(Leu)3 were observed in the i6A-treated dark-grown seedlings compared to dark-grown, light-grown and i6A-treated light-grown seedlings. On the other hand, i6A-treated light-grown seedlings tRNA(Tyr)1 increased to 85% of total tRNAs(Tyr) from about 9% in light-grown seedlings and tRNA(Tyr)2 decreased to 15% compared with 91% in light-grown seedlings. Analysis of modified nucleotide of total tRNAs indicated that pT, pI, pm1A, pm5C, pGm, pm1G, pm2G and pm7G contents were significantly higher in the total tRNA of i6A-treated dark-grown seedlings than those from untreated dark-grown seedlings. Illumination of 8-day-old dark-grown seedlings for 12 h increased the contents of pT, pI, pGm and pm1G when compared to 8-day-old dark-grown seedlings with extended growth for 12 h in dark. On the contrary, i6A had no stimulatory effect in the contents of modified nucleotide in the light-grown seedlings.
Resumo:
The rapid increase in genome sequence information has necessitated the annotation of their functional elements, particularly those occurring in the non-coding regions, in the genomic context. Promoter region is the key regulatory region, which enables the gene to be transcribed or repressed, but it is difficult to determine experimentally. Hence an in silico identification of promoters is crucial in order to guide experimental work and to pin point the key region that controls the transcription initiation of a gene. In this analysis, we demonstrate that while the promoter regions are in general less stable than the flanking regions, their average free energy varies depending on the GC composition of the flanking genomic sequence. We have therefore obtained a set of free energy threshold values, for genomic DNA with varying GC content and used them as generic criteria for predicting promoter regions in several microbial genomes, using an in-house developed tool `PromPredict'. On applying it to predict promoter regions corresponding to the 1144 and 612 experimentally validated TSSs in E. coli (50.8% GC) and B. subtilis (43.5% GC) sensitivity of 99% and 95% and precision values of 58% and 60%, respectively, were achieved. For the limited data set of 81 TSSs available for M. tuberculosis (65.6% GC) a sensitivity of 100% and precision of 49% was obtained.
Resumo:
The complete sequence of a P4 type VP4 gene from a G2 serotype human rotavirus, IS2, isolated in India has been determined. Although the IS2 VP4 is highly homologous to the other P4 type alleles, it contained acidic amino acid substitutions at several positions that make it acidic among the P4 type alleles that are basic. Moreover, comparative sequence analysis revealed unusual polymorphism in members of the P4 type at amino acid position 393 which is highly conserved in members of other VP4 types. To date, expression of complete VP4 inE. coli has not been achieved. In this study we present successful expression inE. coli of the complete VP4 as well as VP8* and VP5* cleavage subunits in soluble form as fusion proteins of the maltose-binding protein (MBP) and their purification by single-step affinity chromatography. The hemagglutinating activity exhibited by the recombinant protein was specifically inhibited by the antiserum raised against it. Availability of pure VP4 proteins should facilitate development of polyclonal and monoclonal antibodies (MAbs) for P serotyping of rotaviruses.
Resumo:
Asymmetric diadenosine tetraphosphate (Ap(4)A) hydrolases degrade the metabolite Ap(4)A back into ATP and AMP. The three-dimensional crystal structure of Ap(4)A hydrolase (16 kDa) from Aquifex aeolicus has been determined in free and ATP-bound forms at 1.8 and 1.95 angstrom resolution, respectively. The overall three-dimensional crystal structure of the enzyme shows an alpha beta alpha-sandwich architecture with a characteristic loop adjacent to the catalytic site of the protein molecule. The ATP molecule is bound in the primary active site and the adenine moiety of the nucleotide binds in a ring-stacking arrangement equivalent to that observed in the X-ray structure of Ap(4)A hydrolase from Caenorhabditis elegans. Binding of ATP in the active site induces local conformational changes which may have important implications in the mechanism of substrate recognition in this class of enzymes. Furthermore, two invariant water molecules have been identified and their possible structural and/or functional roles are discussed. In addition, modelling of the substrate molecule at the primary active site of the enzyme suggests a possible path for entry and/or exit of the substrate and/or product molecule.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA- treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had not detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These date indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.
Resumo:
Transfer RNAs of Azospirillum lipoferum were separated by two- dimensional gel electrophoresis and identified by aminoacylation. Thirty-six tRNA spots were resolved by this technique and twenty-six tRNA species have been identified. There are five tRNAs for Leu, four for Val, three for Pro, two each for Arg, Ile, Lys and Tyr, and one each for Ala, Asp, His, Phe, Ser and Thr. The tRNA(Asn) (QUU) was purified and its nucleotide sequence was determined. The A. lipoferum tRNA(Asn) (QUU) is 92% similar to B. subtilis tRNA(Asn) gene and two hypermodified nucleosides, queuosine (Q) and N-(9-beta-D Ribofuranosylpurine-6-YL) carbamoyl)-threonine (t(6)A) are present in this tRNA.
Resumo:
Inosine 5' monophosphate dehydrogenase (IMPDH II) is a key enzyme involved in the de novo biosynthesis pathway of purine nucleotides and is also considered to be an excellent target for cancer inhibitor design. The conserve R 322 residue (in human) is thought to play some role in the recognition of inhibitor and cofactor through the catalytic D 364 and N 303. The 15 ns simulation and the water dynamics of the three different PDB structures (1B3O, 1NF7, and 1NFB) of human IMPDH by CHARMM force field have clearly indicated the involvement of three conserved water molecules (W-L, W-M, and W-C) in the recognition of catalytic residues (R 322, D 364, and N 303) to inhibitor and cofactor. Both the guanidine nitrogen atoms (NH1 and NH 2) of the R 322 have anchored the di- and mono-nucleotide (cofactor and inhibitor) binding domains via the conserved W-C and W-L water molecules. Another conserved water molecule W-M seems to bridge the two domains including the R 322 and also the W-C and W-L through seven centers H-bonding coordination. The conserved water molecular triad (W-C - W-M - W-L) in the protein complex may thought to play some important role in the recognition of inhibitor and cofactor to the protein through R 322 residue.
Resumo:
Genomic sequences of Helicobacter pylori strains 26695, J99, HPAGI and G27 have revealed an abundance of restriction and modification genes. hp0050, which encodes an N6 adenine DNA methyltransferase, was cloned, overexpressed and purified to near homogeneity. It recognizes the sequence 5'-GRRG-3' (where R is A or G) and, most intriguingly, methylates both adenines when R is A (5'-GAAG-3'). Kinetic analysis suggests a nonprocessive (repeated-hit) mechanism of methylation in which HP0050 methyltransferase methylates one adenine at a time in the sequence 5'-GAAG-3'. This is the first report of an N6 adenine DNA methyltransferase that methylates two adjacent residues on the same strand. Interestingly, HP0050 homologs from two clinical strains of H. pylori (PG227 and 128) methylate only 5'-GAGG-3' compared with 5'-GRRG-3' in strain 26695. HP0050 methyltransferase is highly conserved as it is present in more than 90% of H. pylori strains. Inactivation of hp0050 in strain PG227 resulted in poor growth, suggesting its role in the biology of H. pylori. Collectively, these findings provide impetus for exploring the role(s) of this conserved DNA methyltransferase in the cellular processes of H. pylori.
Resumo:
The commercial acrylic fibre "Cashmilon" was partially hydrolyzed to convert a fraction of its nitrile (-CN) groups to carboxylic acid (-COOH) groups and then coated with polyethylenimine (PEI) resin and cross-linked with glutaraldehyde to produce a novel gel-coated fibrous sorbent with multiple functionalities of cationic, anionic and chelating types, and significantly faster sorption kinetics than bead-form sorbents. The sorption properties of the fibrous sorbent were measured using Zn(II) in aqueous solution as the sorbate to determine the effects of pH and the presence of common ions in the solution on the sorption capacity. The rate of sorption on the gel-coated fibre was measured in comparison with that on Amberlite IRA-68 weak-base resin beads, to demonstrate the marked difference between fibre and bead-form sorbents in their kinetic behaviour.
Resumo:
The complete amino acid sequence of winged bean basic agglutinin (WBA I) was obtained by a combination of manual and gas-phase sequencing methods. Peptide fragments for sequence analyses were obtained by enzymatic cleavages using trypsin and Staphylococcus aureus V8 endoproteinase and by chemical cleavages using iodosobenzoic acid, hydroxylamine, and formic acid. COOH-terminal sequence analysis of WBA I and other peptides was performed using carboxypeptidase Y. The primary structure of WBA I was homologous to those of other legume lectins and more so to Erythrina corallodendron. Interestingly, the sequence shows remarkable identities in the regions involved in the association of the two monomers of E. corallodendron lectin. Other conserved regions are the double metal-binding site and residues contributing to the formation of the hydrophobic cavity and the carbohydrate-binding site. Chemical modification studies both in the presence and absence of N-acetylgalactosamine together with sequence analyses of tryptophan-containing tryptic peptides demonstrate that tryptophan 133 is involved in the binding of carbohydrate ligands by the lectin. The location of tryptophan 133 at the active center of WBA I for the first time subserves to explain a role for one of the most conserved residues in legume lectins.
Resumo:
The commercial acrylic fibre "Cashmilon" was partially hydrolyzed to convert a fraction of its nitrile (-CN) groups to carboxylic acid (-COOH) groups and then coated with polyethylenimine (PEI) resin and cross-linked with glutaraldehyde to produce a novel gel-coated fibrous sorbent with multiple functionalities of cationic, anionic and chelating types, and significantly faster sorption kinetics than bead-form sorbents. The sorption properties of the fibrous sorbent were measured using Zn(II) in aqueous solution as the sorbate to determine the effects of pH and the presence of common ions in the solution on the sorption capacity. The rate of sorption on the gel-coated fibre was measured in comparison with that on Amberlite IRA-68 weak-base resin beads, to demonstrate the marked difference between fibre and bead-form sorbents in their kinetic behaviour.
Resumo:
The excess of free inhibitor for the enzyme NADase present in the crude cell-free extracts of Mycobacterium tuberculosis H37Rv has been purified by chromatography on a DEAE-cellulose column and adsorption and elution from alumina Cγ-gel. Some of the properties of the purified inhibitor have been studied and attempts have been made to elucidate the nature of combination between the enzyme and the inhibitor. The purified inhibitor may be glycoprotein in nature, and considerable loss in the activity of the inhibitor preparations could be brought about by trypsin digestion. The inhibitor was specific for the enzymes from M. tuberculosis H37Rv or H37Ra and could be stored for at least 6 months in the frozen state below 0 ° without any significant loss in activity. The inhibition was noncompetitive with respect to the substrates, and the enzyme-inhibitor complex formed was undissociable.