270 resultados para SPECTRAL SEQUENCE
Resumo:
Adsorption of CO has been investigated on the surfaces of polycrystalline transition metals as well as alloys by employing electron energy loss spectroscopy (eels) and ultraviolet photoelectron spectroscopy (ups). CO adsorbs on polycrystalline transition metal surfaces with a multiplicity of sites, each being associated with a characteristic CO stretching frequency; the relative intensities vary with temperature as well as coverage. Whilst at low temperatures (80- 120 K), low coordination sites are stabilized, the higher coordination sites are stabilized at higher temperatures (270-300 K). Adsorption on surfaces of polycrystalline alloys gives characteristic stretching frequencies due to the constituent metal sites. Alloying, however, causes a shift in the stretching frequencies, indicating the effect of the band structure on the nature of adsorption. The up spectra provide confirmatory evidence for the existence of separate metal sites in the alloys as well as for the high-temperature and low-temperature phases of adsorbed CO.
Resumo:
Assignments of the infrared frequencies of methyl and ethyl xanthato complexes of nickel(II) have been made with the aid of normal coordinate analyses. The assignments are discussed in relation to those in related molecules.
Resumo:
The i.r. frequencies of ethylthioxanthate complexes of some transition metals have been interpreted on the basis of normal coordinate treatments of the 1:1 molecular models. The band assignments are disscussed in comparison with those in closely related xanthate molecules.
Resumo:
Abstract is not available.
Resumo:
The complexes of thiophene 2-thiocarboxamide (TTCA) with some metal chlorides and bromides [M = Ni(II), Zn(II), Cd(II), Hg(II) and Cu(I)] are described. Elemental analyses, magnetic susceptibilities and conductance studies, electronic, IR, proton and 13C magnetic resonance spectra are reported. The results suggest exclusive coordination of TTCA through the thiocarbonyl sulfur. The influence of the thiophene ring on the donor properties of the thioamide are discussed.
Resumo:
The H1',H2' and H2″ regions of the 270-MHz PMR spectra of two deoxydinucleotides, d-pTpA and d-pApT, have been analyzed. The coupling constants in the sugar ring indicate that both A and T sugars have a tendency to acquire 2E conformations. There is also a marginal difference in the 2E populations of the T sugar in the two dinucleotides. The trends in the chemical shifts of base protons indicate different stacking of the bases in d-pApT and d-pTpA. The sequence effects on base stacking and pentose conformation are discussed.
Resumo:
Based upon a stereochemical guideline, two topologically distinct types of helicalduplexes have been deduced for a polynucleotide duplex with alternating purine pyrimidine sequence (PAPP): (a) right-handed uniform (RU) helix and (b) left-handed zig-zag (LZ) helix. Both structures have trinucleoside diphosphate as the basic unit wherein the purine pyrimidine fragment has a different conformation from the pyrimidine-purine fragment. Thus, RU and LZ helices represent two different classes of sequence-dependent molecular conformations for PAPP. The conformationalf eatures of an RU helix of PAPP in B-form and three LZ-helices for B-, D- and Z-forms are discussed.
Resumo:
In an earlier communication[l] we have indicated a general graphical design procedure for a sequence of sparger reactors in which a second order liquid phase reaction proceeds in a stagewise fashion. The prediction of the reactant concentration in each stage and hence the conversion depended on a search procedure initiated along a straight line representing the mass balance equation at the given stage and drawn from the known feed stage located on the abscissa in a E-IU diagram for the given system.
Resumo:
The effect of phenobarbital on the rates of the synthesis of the protein and heme moieties of cytochrome P-450 has been studied. For this purpose, cytochrome P-450 has been partially purified as its P-420 derivative and the labeled amino acid incorporation into the protein has been studied after subjecting a partially purified preparation to sodium dodecyl sulfate gel electrophoresis. The incorporation studies into the protein species after sodium dodecyl sulfate gel electrophoresis reveal that the drug primarily accelerates the rate of apoprotein synthesis followed by an increase in the rate of heme synthesis. The messenger for apocytochrome P-450 appears to be fairly stable.
Resumo:
The sequence distribution studies on the acrylonitrile-methylmethacrylate copolymer of high methylmethacrylate (M) content (30%
Resumo:
Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.
Resumo:
Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.
Resumo:
The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.