Molecular orbital studies on some 4-substituted pyridine N-oxides and 4-nitroquinoline N-oxide

The electronic structures of a series of 4-substituted pyridine N-oxides and 4-nitroquinoline N-oxide are investigated using the simple Pariser-Parr-Pople (PPP), a modified PPP, IEH and MINDO/2 methods. The electronic absorption band maxima and dipole moments are calculated and compared with experimental values. The photoelectron spectra of these compounds are assigned. The nature of the N-oxide group is characterized using the orbital population distributions. The antifungal activity exhibited by some of these compounds is discussed in terms of the nucleophilic frontier electron densities, superdelocalizabilities and electron acceptor properties. The effect of the electron releasing as well as the electron withdrawing substituents on the physico-chemical properties is explained.

Preparation, properties and metabolism of retinoic acid anhydride.

A new analogue of vitamin A, viz., retinoic acid anhydride was prepared, for the first time, by the action of thionyl chloride on retinoic acid in benzene containing pyridine. The amhydride was charcterised by its chromatographic properties, elemental analysis, ultraviolet absorption, infrared and nuclear magnetic resonance spectral characteristics. The compound could be readily hydrolysed to retinoic acid both by acid and alkali treatments and reduced by lithium aluminium hydride to vitamin A alcohol (retinol). The spectral changes with antimony trichloride reagent were similar to those observed for retinoic acid. The metabolism of retinoic acid anhydride was found to be similar to that of retinoic acic. When administered either orally or intraperitoneally, the compound promotes growth in vitamin A-deficient rats. Time-course experiments revealed that retinoic acid anhydride is converted into retinoic acid by non-enzymatic hydrolysis and thereby exerts its biological activity. The biopotency of the anhydride was found to be nearly the same as that of the acid. A new method of preparing esters of retinoic acid employing retinoic acid anhydride as an intermediate, has been described.

Oxidase-peroxidase enzymes of Datura innoxia. Oxidation of reduced nicotinamide-adenine dinucleotide in the presence of formylphenylacetic acid ethyl ester

The oxidase-peroxidase from Datura innoxia which catalyses the oxidation of formylphenylacetic acid ethyl ester to benzoylformic acid ethyl ester and formic acid was also found to catalyse the oxidation of NADH in the presence of Mn2+ and formylphenylacetic acid ethyl ester. NADH was not oxidized in the absence of formylphenylacetic acid ethyl ester, although formylphenylacetonitrile or phenylacetaldehyde could replace it in the reaction. The reaction appeared to be complex and for every mol of NADH oxidized 3-4 g-atoms of oxygen were utilized, with a concomitant formation of approx. 0.8 mol of H2O2, the latter being identified by the starch-iodide test and decomposition by catalase. Benzoylformic acid ethyl ester was also formed in the reaction, but in a nonlinear fashion, indicating a lag phase. In the absence of Mn2+, NADH oxidation was not only very low, but itself inhibited the formation of benzoylformic acid ethyl ester from formylphenylacetic acid ethyl ester. A reaction mechanism for the oxidation of NADH in the presence of formylphenylacetic acid ethyl ester is proposed.

Neutron-diffraction study of structure and conformation of nucleotide uridine-5 phosphate (disodium salt)

Acta Crystallographica Section A: Foundations of Crystallography covers theoretical and fundamental aspects of the structure of matter. The journal is the prime forum for research in diffraction physics and the theory of crystallographic structure determination by diffraction methods using X-rays, neutrons and electrons. The structures include periodic and aperiodic crystals, and non-periodic disordered materials, and the corresponding Bragg, satellite and diffuse scattering, thermal motion and symmetry aspects. Spatial resolutions range from the subatomic domain in charge-density studies to nanodimensional imperfections such as dislocations and twin walls. The chemistry encompasses metals, alloys, and inorganic, organic and biological materials. Structure prediction and properties such as the theory of phase transformations are also covered.

Pyridine-1-oxide complexes of lanthanide iodides

Pyridine-1-oxide complexes of lanthanide iodides of the formulaLn(PyO)8I3 whereLn=La, Pr, Nd, Tb, Dy, Er, and Yb have been prepared and characterised by analyses, molecular weight, conductance, infrared and proton NMR data. Proton NMR and IR data have shown the coordination of the ligand to the metal through the oxygen atom of the N–O group. NMR data have been interpreted in terms of a distorted square antiprismatic geometry in solution.

An approach for sensitivity-reduced design of linear regulators

A now procedure for the design of sensitivity-reduced control for linear regulators is described. The control is easily computable and implementable since it requires neither the solution of an increased-order augmented system nor the generation and feedback of a trajectory sensitivity vector. The method provides a trade-off between reduction in sensitivity measure and increase in performance index.

Studies on nucleotidases in plants Dimerization of the crystalline mung bean nucleotide pyrophosphatase by 5-adenosine monophosphate and the properties of the dimerized enzyme

The addition of AMP to the crystalline and homogeneous mung bean nucleotide pyrophosphatase [EC 3.6.1.9]altered its electrophoretic mobility. AMP was tightly bound to the enzyme and was not removed on passage through a column of Sephadex G-25 or on electrophoresis. The molecular weight of the native and AMP-modified enzymes were 65,000 and 136,000, respectively. The properties of the native enzyme such as the pH (9.4) and temperature (49 °C) optima, inhibition by EDTA, reversal of EDTA-inhibition by Zn2+ and Co2+, were not altered on dimerization by AMP. The AMP-modified enzyme had a linear time-course of reaction, unlike the native enzyme which exhibited a biphasic time-course of reaction. The AMP-modified enzyme was irreversibly denatured by urea. AMP concentrations larger than 100 μM inhibited linearly the activity of the AMP-modified enzyme. ADP and ATP inhibited the activity in a sigmoidal manner. Km and V of the native and AMP-modified enzymes were, 0.25 mImage and 0.58 mImage ; and 3.3 and 2.5, respectively.

Nucleotide sequence of the 3' terminal region of belladonna mottle virus-Iowa (renamed Physalis mottle virus) RNA and an analysis of the relationships of tymoviral coat proteins

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

4-Nitro and 4-chloro pyridine-N-oxide complexes of lanthanide perchlorates

Adducts of lanthanide perchlorates with 4-nitro and 4-chloro pyridine-Noxides (4-NPNO and 4-CPNO respectively) have been synthesised for the first time and characterised by analysis, electrolytic conductance, infrared, proton-NMR and electronic spectral data. The complexes are of the compositions Ln2(NPNO)15 (ClO4)6 (Ln = La, Pr, Nd and Gd), Tb(NPNO), (C1O4)6), Ln2(NPNO)13 (C1O4)6) (Ln = Dy, Ho, and Yb); Ln (CPNO)8 (C104)3) (Ln = La, Pr, Nd, Tb, Dy, Ho and Yb) and Ln(CPNO), (C1O4)3) (Ln = Sm and Gd). Conductivity and IR data provide evidence for the non-coordinated nature of the perchlorate groups. IR and NMR spectra suggest coordinationvia the oxygen of the N-oxide group. Electronic spectral shapes of the Nd+3 and Ho+3 complexes are interpreted in terms of eight-and seven-coordinate environments in the case of 4-NPNO complexes and eight-coordination in the case of 4-CPNO complexes. IR data indicate bridged structure in NPNO complexes of lanthanides other than Tb.

Light- and cytokinin-induced changes in the levels of leucine and tyrosine isoaccepting tRNA species and modified nucleotide contents of total tRNA in cucumber seedlings

We have determined relative levels of chloroplast leucine and tyrosine isoaccepting tRNAs and modified nucleotide contents from total tRNAs isolated from dark-grown, light-grown, N6-isopentenyladenine (i6A)-treated dark-grown and i6A-treated light-grown cucumber seedlings. Significant increases in the relative amounts of tRNA(Leu)2 and tRNA(Leu)3 were observed in the i6A-treated dark-grown seedlings compared to dark-grown, light-grown and i6A-treated light-grown seedlings. On the other hand, i6A-treated light-grown seedlings tRNA(Tyr)1 increased to 85% of total tRNAs(Tyr) from about 9% in light-grown seedlings and tRNA(Tyr)2 decreased to 15% compared with 91% in light-grown seedlings. Analysis of modified nucleotide of total tRNAs indicated that pT, pI, pm1A, pm5C, pGm, pm1G, pm2G and pm7G contents were significantly higher in the total tRNA of i6A-treated dark-grown seedlings than those from untreated dark-grown seedlings. Illumination of 8-day-old dark-grown seedlings for 12 h increased the contents of pT, pI, pGm and pm1G when compared to 8-day-old dark-grown seedlings with extended growth for 12 h in dark. On the contrary, i6A had no stimulatory effect in the contents of modified nucleotide in the light-grown seedlings.

Metal-Nucleotide Interactions: Crystal Structures of Alkali (Li+, Na+, K+) and Alkaline Earth (Ca2+, Mg2+) Metal Complexes of Adenosine 2'-Monophosphate

Crystal structures of lithium, sodium, potassium, calcium and magnesium salts of adenosine 2'-monophosphate (2'-AMP) have been obtained at atomic resolution by X-ray crystallographic methods. 2'-AMP.Li belongs to the monoclinic space group P21 with a = 7.472(3)Å, b = 26.853(6) Å, c = 9.184(1)Å, b = 113.36(1)Å and Z= 4. 2'-AMP.Na and 2'-AMP.K crystallize in the trigonal space groups P31 and P3121 with a = 8.762(1)Å, c = 34.630(5)Å, Z= 6 and a = 8.931(4), Åc = 34.852(9)Å and Z= 6 respectively while 2'-AMP.Ca and 2'-AMP.Mg belong to space groups P6522 and P21 with cell parameters a = 9.487(2), c = 74.622(13), Z = 12 and a = 4.973(1), b = 10.023(2), c = 16.506(2), beta = 91.1(0) and Z = 2 respectively. All the structures were solved by direct methods and refined by full matrix least-squares to final R factors of 0.033, 0.028, 0.075, 0.069 and 0.030 for 2'-AMP.Li, 2'-AMP.Na, 2'- AMP.K, 2'-AMP.Ca and 2'-AMP.Mg, respectively. The neutral adenine bases in all the structures are in syn conformation stabilized by the O5'-N3 intramolecular hydrogen bond as in free acid and ammonium complex reported earlier. In striking contrast, the adenine base is in the anti geometry (cCN = -156.4(2)°) in 2'-AMP.Mg. Ribose moieties adopt C2'-endo puckering in 2'-AMP.Li and 2'-AMP.Ca, C2'-endo-C3'-exo twist puckering in 2'-AMP.Na and 2'-AMP.K and a C3'-endo-C2'-exo twist puckering in 2'-AMP.Mg structure. The conformation about the exocyclic C4'-C5' bond is the commonly observed gauche-gauche (g+) in all the structures except the gauche- trans (g-) conformation observed in 2'-AMP.Mg structure. Lithium ions coordinate with water, ribose and phosphate oxygens at distances 1.88 to 1.99Å. Na+ ions and K+ ions interact with phosphate and ribose oxygens directly and with N7 indirectly through a water oxygen. A distinct feature of 2'-AMP.Na and 2'-AMP.K structures is the involvement of ribose O4' in metal coordination. The calcium ion situated on a two-fold axis coordinates directly with three oxygens OW1, OW2 and O2 and their symmetry mates at distances 2.18 to 2.42Å forming an octahedron. A classic example of an exception to the existence of the O5'-N3 intramolecular hydorgen bond is the 2'-AMP.Mg strucure. Magnesium ion forms an octahedral coordination with three water and three phosphate oxygens at distances ranging from 2.02 to 2.11Å. A noteworthy feature of its coordination is the indirect link with N3 through OW3 oxygen resulting in macrochelation between the base and the phosphate group. Greater affnity of metal clays towards 5' compared to 2' and 3' nucleotides (J. Lawless, E. Edelson, and L. Manring, Am. Chem. Soc. Northwest Region Meeting, Seattle. 1978) due to macrochelation infered from solution studies (S. S. Massoud, H. Sigel, Eur. J. Biochem. 179, 451-458 (1989)) and interligand hydrogen bonding induced by metals postulated from metal-nucleotide structures in solid state (V. Swaminathan and M. Sundaralingam, CRC. Crit. Rev. Biochem. 6, 245-336 (1979)) are borne out by our structures also. The stacking patterns of adenine bases of both 2'-AMP.Na and 2'-AMP.K structures resemble the 2'-AMP.NH4 structure reported in the previous article. 2'-AMP.Li, 2'-AMP.Ca and 2'-AMP.Mg structures display base-ribose O4' stacking. An overview of interaction of monovalent and divalent cations with 2' and 5'-nucleotides has been presented.

Lanthanide perchlorate complexes of picolinamide-N-oxide and 4-chloro pyridine 2-aldoxime-N-oxide

Abstract is not available.

Relative stability of DNA as a generic criterion for promoter prediction: whole genome annotation of microbial genomes with varying nucleotide base composition

The rapid increase in genome sequence information has necessitated the annotation of their functional elements, particularly those occurring in the non-coding regions, in the genomic context. Promoter region is the key regulatory region, which enables the gene to be transcribed or repressed, but it is difficult to determine experimentally. Hence an in silico identification of promoters is crucial in order to guide experimental work and to pin point the key region that controls the transcription initiation of a gene. In this analysis, we demonstrate that while the promoter regions are in general less stable than the flanking regions, their average free energy varies depending on the GC composition of the flanking genomic sequence. We have therefore obtained a set of free energy threshold values, for genomic DNA with varying GC content and used them as generic criteria for predicting promoter regions in several microbial genomes, using an in-house developed tool `PromPredict'. On applying it to predict promoter regions corresponding to the 1144 and 612 experimentally validated TSSs in E. coli (50.8% GC) and B. subtilis (43.5% GC) sensitivity of 99% and 95% and precision values of 58% and 60%, respectively, were achieved. For the limited data set of 81 TSSs available for M. tuberculosis (65.6% GC) a sensitivity of 100% and precision of 49% was obtained.

Nucleotide sequence and expression inE. coli of the complete P4 type VP4 from a G2 serotype human rotavirus

The complete sequence of a P4 type VP4 gene from a G2 serotype human rotavirus, IS2, isolated in India has been determined. Although the IS2 VP4 is highly homologous to the other P4 type alleles, it contained acidic amino acid substitutions at several positions that make it acidic among the P4 type alleles that are basic. Moreover, comparative sequence analysis revealed unusual polymorphism in members of the P4 type at amino acid position 393 which is highly conserved in members of other VP4 types. To date, expression of complete VP4 inE. coli has not been achieved. In this study we present successful expression inE. coli of the complete VP4 as well as VP8* and VP5* cleavage subunits in soluble form as fusion proteins of the maltose-binding protein (MBP) and their purification by single-step affinity chromatography. The hemagglutinating activity exhibited by the recombinant protein was specifically inhibited by the antiserum raised against it. Availability of pure VP4 proteins should facilitate development of polyclonal and monoclonal antibodies (MAbs) for P serotyping of rotaviruses.