126 resultados para 143-868
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
Crystalline complexes of succinic acid with DL- and L-lysine have been prepared and analysed by X-ray diffraction. DL-Lysine complex: C6HIsN202 + 1 2- 1 ~C4H404 .~C4H604, Mr -- 264"2, PI, a = 5"506 (4), =8.070(2), c=14.089(2) A,, a=92.02(1), /3= 100"69 (3), y = 95"85 (3) ~>, Z = 2, Dx = 1"44 g cm -3, R = 0.059 for 2546 observed reflections. Form I of the e-lysine complex: C6HIsN20-, ~ .C4H504, Mr = 264.2, P1, a = 5" 125 (2), b = 8"087 (1), c = 8"689 (1) A,, a = 112.06 (1), /3 = 99.08 (2), y = 93"77(2) °, Z--l, D,,,=1"34(3), Dx=l"34gcm 3 R = 0.033 for 1475 observed reflections. Form II of + I 2- the e-lysine complex: C6H15N202 .,iC4H404 .- 1 I ") 4C4H604.4(C4HsO4""H'"CaH404)" , Mr = 264"2, P1, a = 10.143 (4), b = 10.256 (2), c = 12"916 (3) A,, a = 105.00 (2),/3 = 99-09 (3), y = 92"78 (3)::, Z = 4, Dm= 1"37(4), D,.= 1.38gcm 3, R=0.067 for 2809 observed reflections. The succinic acid molecules in the structures exhibit a variety of ionization states. Two of the lysine conformations found in the complexes have been observed for the first time in crystals containing lysine. Form II of the L-lysine complex is highly pseudosymmetric. In all the complexes, unlike molecules aggregate into separate alternating layers. The basic element of aggregation in the lysine layer in the complexes is an S2-type head-to-tail sequence. This element combines in different ways in the three structures. The basic element of aggre gation in the succinic acid layer in the complexes is a hydrogen-bonded ribbon. The ribbons are interconnected indirectly through amino groups in the lysine layer.
Resumo:
The PRP17 gene product is required for the second step of pre-mRNA splicing reactions. The C-terminal half of this protein bears four repeat units with homology to the beta transducin repeat. Missense mutations in three temperature-sensitive prp17 mutants map to a region in the N-terminal half of the protein. We have generated, in vitro, 11 missense alleles at the beta transducin repeat units and find that only one affects function in vivo. A phenotypically silent missense allele at the fourth repeat unit enhances the slow-growing phenotype conferred by an allele at the third repeat, suggesting an interaction between these domains. Although many missense mutations in highly conserved amino acids lack phenotypic effects, deletion analysis suggests an essential role for these units. Only mutations in the N-terminal nonconserved domain of PRP17 are synthetically lethal in combination with mutations in PRP16 and PRP18, two other gene products required for the second splicing reaction. A mutually allele-specific interaction between Prp17 and snr7, with mutations in U5 snRNA, was observed. We therefore suggest that the functional region of Prp17p that interacts with Prp18p, Prp16p, and U5 snRNA is the N terminal region of the protein.
Resumo:
Biosensors have gained immense acceptance in the field of medical diagnostics, besides environmental, food safety and biodefence applications due to its attributes of real-time and rapid response. This synergistic combination of biotechnology and microelectronics comprises a biological recognition element coupled with a compatible transducer device. Diabetes is a disease of major concern since the ratio of world population suffering from it is increasing at an alarming rate and therefore the need for development of accurate and stable glucose biosensors is evident. There are many commercial glucose biosensors available yet some limitations need attention. This review presents a detailed account of the polypyrrole based amperometric glucose biosensors. The polymer polypyrrole is used extensively as a matrix for immobilization of glucose oxidase enzyme owing to its favourable features such as stability under ambient conditions, conductivity that allows it to be used as an electron relay, ability to be polymerized under neutral and aqueous mild conditions, and more. The simple one-step electrodeposition on the electrode surface allows easy entrapment of the enzyme. The review is structured into three categories (a) the first-stage biosensors: which report the studies from the inception of use of polypyrrole in glucose biosensors during which time the role of the polymer and the use of mediators was established. This period saw extensive work by two separate groups of Schuhmann and Koopal who contributed a great deal in understanding the electron transfer pathways in polypyrrole based glucose biosensors, (b) the second-stage biosensors: which highlight the shift of polypyrrole from a conventional matrix to composite matrices with extensive use of mediators focused at improving the selectivity of response, and (c) third-stage biosensors: the remarkable properties of nanoparticles and carbon nanotubes and their outstanding ability to mediate electrontransfers have seen their indispensable use in conjugation with polypyrrole for development of glucose biosensors with improved sensitivity and stability characteristics which is accounted in the review, which thus traces the evolution of polypyrrole from a conventional matrix, to composites and thence to the form of nanotube arrays, with the objective of addressing the vital issue of diabetes management through the development of stable and reliable glucose biosensors.
Resumo:
The keto-enol type tautomerism in anti-thyroid drugs and their selenium analogues are described. The commonly used anti-thyroid drug methimazole exists predominantly in its thione form, whereas its selenium analogue exists in a zwitterionic form. To understand the effect of thione/thiol and selone/selenol tautomerism on the inhibition of peroxidase-catalysed reactions, we have synthesized some thiones and selones in which the formation of thiol/selenol forms are blocked by different substituents. These compounds were synthesized by a carbene route utilizing an imidazolium salt. The crystal structures of these compounds reveal that the C=Se bonds in the selones are more polarized than the C=S bonds in the corresponding thiones. The structures of selones were studied in solution by NMR spectroscopy and the 77Se NMR chemical shifts for the selones show large upfield shifts in the signals, confirming their zwitterionic structures in solution. The inhibition of lactoperoxidase by the synthetic thiones indicates that the presence of a free N-H moiety is essential for an efficient inhibition. In contrast, such moiety is not required for an inhibition by the selenium compounds.
Resumo:
In1-xMnxSb films have been grown with different Mn doping concentrations (x = 0.0085, 0.018, 0.029 and 0.04) beyond the equilibrium 14 solubility limit by liquid phase epitaxy. We have studied temperature dependent resistivity, the Hall effect, magnetoresistance and magnetization for all compositions. Saturation in magnetization observed even at room temperature suggests the existence of ferromagnetic clusters in the film which has been verified by scanning electron microscopy studies. The anomalous Hall coefficient is found to be negative. Remnant field present on the surface of the clusters seems to affect the anomalous Hall effect at very low fields (below 350 Gauss). In the zero field resistivity, a variable-range hopping conduction mechanism dominates below 3.5 K for all samples above which activated behavior is predominant. The temperature dependence of the magnetization measurement shows a magnetic ordering below 10 K which is consistent with electrical measurements. (c) 2007 Elsevier Ltd. All rights reserved.
Resumo:
In this paper an approach for obtaining depth and section modulus of the cantilever sheet pile wall using inverse reliability method is described. The proposed procedure employs inverse first order reliability method to obtain the design penetration depth and section modulus of the steel sheet pile wall in order that the reliability of the wall against failure modes must meet a desired level of safety. Sensitivity analysis is conducted to assess the effect of uncertainties in design parameters on the reliability of cantilever sheet pile walls. The analysis is performed by treating back fill soil properties, depth of the water table from the top of the sheet pile wall, yield strength of steel and section modulus of steel pile as random variables. Two limit states, viz., rotational and flexural failure of sheet pile wall are considered. The results using this approach are used to develop a set of reliability based design charts for different coefficients of variation of friction angle of the backfill (5%, 10% and 15%). System reliability considerations in terms of series and parallel systems are also studied.
Resumo:
Some naturally occurring strains of fungi cease growing through successive subculturing, i.e., they senesce. In Neurospora, senescing strains usually contain intramitochondrial linear or circular plasmids. An entire plasmid or its part(s) integrates into the mtDNA, causing insertional mutagenesis. The functionally defective mitochondria replicate faster than the wild-type mitochondria and spread through interconnected hyphal cells. Senescence could also be due to spontaneous lethal nuclear gene mutations arising in the multinucleated mycelium. However, their phenotypic effects remain masked until the nuclei segregate into a homokaryotic spore, and the spore germinates to form a mycelium that is incapable of extended culturing. Ultimately the growth of a fungal colony ceases due to dysfunctional oxidative phosphorylation. Results with senescing nuclear mutants or growth-impaired cytoplasmic mutants suggest that mtDNA is inherently unstable, requiring protection by as yet unidentified nuclear-gene-encoded factors for normal functioning. Interestingly, these results are in accord with the endosymbiotic theory of origin of eukaryotic cells.
Resumo:
A chenodeoxycholic acid based K+ ion sensor has been designed using a modular approach in which a fluorophore and a cation receptor are attached to the bile acid backbone. In the absence of K+ the fluorescence of the molecule is quenched because of through-space, photo-induced electron-transfer from the aza-crown unit. Fluorescence enhancement was observed upon titration with K+ (and other alkali metal ions too). In methanol, good selectivity towards the sensing of K+ has been observed.
Resumo:
A novel alkaline direct borohydride fuel cell (ADBFC) using varying concentrations of hydrogen peroxide as oxidant and sodium borohydride with sodium hydroxide, each of differing concentration, as fuel is reported. A peak power density of ca. 150 in W cm(-2) at a cell voltage of 540 mV can be achieved from the optimized ADBFC operating at 70 degrees C. (c) 2004 Elsevier B.V. All rights reserved.
Resumo:
Artificial superlattices of SrTiO3 and BaZrO3 were grown epitaxially with different periodicities on SrRuO3 coated (00 1) SrTiO3 substrates by pulsed excimer laser ablation. Superlattices were structurally characterized by X-Ray theta-2 theta diffraction data. Electrical characterization was done in metal-insulation-metal configuration. Capacitance-voltage measurements showed limited amount of tunability. The DC field induced tunability has been observed to be sensitive to the periodicity of the superlattices, hence the effective strain present in the layers. Hysteretic behaviour in capacitance-voltage (C-V) and polarization versus electric field (P-E) results from the superlattices also indicate the sensitivity of the interfaces. Interfacial strain is supposed to be the most probable cause for such a behaviour which is also manifested in the variation of dielectric constant with individual layer thicknesses. (c) 2007 Elsevier Ltd. All rights reserved.
Resumo:
A novel alkaline direct borohydride fuel cell (ADBFC) using varying concentrations of hydrogen peroxide as oxidant and sodium borohydride with sodium hydroxide, each of differing concentration, as fuel is reported. A peak power density of ca. 150 in W cm(-2) at a cell voltage of 540 mV can be achieved from the optimized ADBFC operating at 70 degrees C. (c) 2004 Elsevier B.V. All rights reserved.
Resumo:
A temperature dependence has been observed in the spin-Hamiltonian parameters of the Cu++ ion in a tetragonal crystal field and the variation has been interpreted in terms of vibronic effects.
Resumo:
The stability of an incompressible inviscid, perfectly conducting cylindrical plasma against azimuthal disturbances in the presence of a monotonic decreasing magnetic field having a constant pitch is discussed by using energy principle. The results obtained by this principle are compared for m = 1 mode (which is a dangerous mode in which there is a lateral shift of the entire column) with that obtained by normal mode analysis. It is found that m = 1 mode is always unstable. Further, an axial line current, external axial field and the surface tension tend to stabilise m ≠ modes.
Resumo:
Successive administrations of allylisopropylacetamide, a potent porphyrinogenic drug, increase liver weight, microsomal protein and phospholipid contents. There is an increase in the rate of microsomal protein synthesis in vivo and in vitro. The drug decreases microsomal ribonuclease activity and increases NADPH-cytochrome c reductase activity. Phenobarbital, which has been reported to exhibit all these changes mentioned, is a weaker inducer of delta-aminolaevulinate synthetase and increases the rate of haem synthesis only after a considerable time-lag in fed female rats, when compared with the effects observed with allylisopropylacetamide. Again, phenobarbital does not share the property of allylisopropylacetamide in causing an initial decrease in cytochrome P-450 content. Haematin does not counteract most of the biochemical effects caused by allylisopropylacetamide, although it is quite effective in the case of phenobarbital. Haematin does not inhibit the uptake of [2-(14)C]allylisopropylacetamide by any of the liver subcellular fractions.