An explanation for the rare occurrence of cis peptide units in proteins and polypeptides

The rarity of occurrence of cis peptide units is only partially explained by the higher intrinsic energy of the cis over the trans form, which provides a probability of 0·01 for cis peptide units to occur. An additional factor is the conformational restriction imposed by the occurrence of a cis peptide unit in a chain of trans units. Taking a section of three peptide units having the sequences trans-trans-trans (ttt) and trans-cis-trans (tct), conformational energy calculations indicate that the latter can occur only to an extent of 0·1%, unless there occurs the sequence X-Pro, in which case it is of the order of 30%. This explains the extreme rarity of cis peptide units, in general; however, it follows that even with non-prolyl residues, cis peptide units are not forbidden, but can occur in some rare examples and should be looked for.

Polypurine/polypyrimidine sequences as cis-acting transcriptional regulators

Genome sequence information has generated increasing evidence for the claim that repetitive DNA sequences present within and around genes could play a important role in the regulation of gene expression. Polypurine/polypyrimidine sequences [poly(Pu/Py)] have been observed in the vicinity of promoters and within the transcribed regions of many genes. To understand whether such sequences influence the level of gene expression, we constructed several prokaryotic and eukaryotic expression vectors incorporating poly(Pu/Py) repeats both within and upstream of a reporter gene, lacZ (encoding β-galactosidase), and studied its expression in vivo. We find that, in contrast to the situation in Escherichia coli, the presence of poly(Pu/Py) sequences within the gene does not significantly inhibit gene expression in mammalian cells. On the other hand, the presence of such sequences upstream of lacZ leads to a several-fold reduction of gene expression in mammalian cells. Similar down-regulation was observed when a structural cassette containing poly(Pu/Py) sequences upstream of lacZ was integrated into yeast chromosome V. Sequence analysis of the nine totally sequenced yeast chromosomes shows that a large number of such sequences occur upstream of ORFs. On the basis of our experimental results and DNA sequence analysis, we propose that these sequences can function as cis-acting transcriptional regulators.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Positional Preferences of Polypurine/Polypyrimidine Tracts in Saccharomyces cerevisiae Genome: Implications for cis Regulation of Gene Expression

The complete genome of the baker's yeast S. cerevisiae was analyzed for the presence of polypurine/polypyrimidine (poly[pu/py]) repeats and their occurrences were classified on the basis of their location within and outside open reading frames (ORFs). The analysis reveals that such sequence motifs are present abundantly both in coding as well as noncoding regions. Clear positional preferences are seen when these tracts occur in noncoding regions. These motifs appear to occur predominantly at a unit nucleosomal length both upstream and downstream of ORFs. Moreover, there is a biased distribution of polypurines in the coding strands when these motifs occur within open reading frames. The significance of the biased distribution is discussed with reference to the occurrence of these motifs in other known mRNA sequences and expressed sequence tags. A model for cis regulation of gene expression is proposed based on the ability of these motifs to form an intermolecular triple helix structure when present within the coding region and/or to modulate nucleosome positioning via enhanced histone affinity when present outside coding regions.

Identification and functional characterization of a cis-acting positive DNA element regulating CYP 2B1/B2 gene transcription in rat liver

A positive cis-acting DNA element in the near 5'-upstream region of the CYP2B1/B2 genes in rat liver was found to play an important role in the transcription of these genes. An oligonucleotide covering -69 to -98 nt mimicked the gel mobility shift pattern given by the fragment -179 to +29 nt, which was earlier found adequate to confer the regulatory features of this gene. Two major complexes were seen, of which the slower and faster moving complexes became intense under uninduced and Phenobarbitone-induced conditions respectively. Minigene cloned DNA plasmid covering -179 to +181 nt in pUC 19 and Bal 31 mutants derived from this parent were transcribed in whole nuclei and cell free transcription extracts and mutants containing only upto -75 nt of the upstream were poorly transcribed. Transcription extracts from phenobarbitone-injected rat liver nuclei were significantly more active than extracts from uninduced rats in transcribing the minigene constructs. Addition of the oligonucleotide (-69 to -98nt) specifically inhibited the transcription of the minigene construct (-179 to +181 nt) in the cell free transcription system. It is therefore, concluded that the region -69 to -98 nt acts as a positive cis-acting element in the transcription of the CYP2B1/B2 genes and in mediating the inductive effects of phenobarbitone.

Transcriptional Silencing of a tRNA1Gly Copy from within a Multigene Family Is Modulated by Distal cis Elements

Individual copies of tRNA1Gly from within the multigene family in Bombyx mori could be classified based on in vitro transcription in homologous nuclear extracts into three categories of highly, moderately, or weakly transcribed genes. Segregation of the poorly transcribed gene copies 6 and 7, which are clustered in tandem within 425 base pairs, resulted in enhancement of their individual transcription levels, but the linkage itself had little influence on the transcriptional status. For these gene copies, when fused together generating a single coding region, transcription was barely detectable, which suggested the presence of negatively regulating elements located in the far flanking sequences. They exerted the silencing effect on transcription overriding the activity of positive regulatory elements. Systematic analysis of deletion, chimeric, and mutant constructs revealed the presence of a sequence element TATATAA located beyond 800 nucleotides upstream to the coding region acting as negative modulator, which when mutated resulted in high level transcription. Conversely, a TATATAA motif reintroduced at either far upstream or far downstream flanking regions exerted a negative effect on transcription. The location of cis-regulatory sequences at such farther distances from the coding region and the behavior of TATATAA element as negative regulator reported here are novel. These element(s) could play significant roles in activation or silencing of genes from within a multigene family, by recruitment or sequestration of transcription factors.

Racemization at proline residues during peptide bond formation : A study of diastereomeric mixtures of synthetic alamethicin fragments by 270 MHz 1H NMR

The stepwise synthesis of amino terminal pentapeptide of alamethicin, Z-Aib-Pro-Aib-Ala-Aib-OMe, by the dicyclohexylcarbodiimide mediated couplings leads to extensive racemization at the Ala and Pro residues. Racemization is largely suppressed by the use of additives like N-hydroxysuccinimide and 1-hydroxybenzotriazole. The presence of diastereomeric peptides may be detected by the observation of additional methyl ester and benzylic methylene signals in the 270 MHz 1H NMR spectra. Unambiguous spectral assignment of the signals to the diastereomers has been carried out by the synthesis and NMR studies of the D-Ala tetra and pentapeptides. The racemization at Pro is of particular relevance in view of the reported lack of inversion at C-terminal Pro on carboxyl activation.

Enantioselective syntheses of cis, syn, cis- and cis, anti, cis-linear triquinanes

Enantioselective syntheses of both cis, syn, cis- and cis, anti, cis-linear triquinanes, starting from the readily available (S)-campholenaldehyde, employing an RCM reaction-based cyclopentannulation strategy, are described.

Enantioselective syntheses of diquinane and (cis, anti, cis)-linear triquinanes

The enantioselective syntheses of diquinane and cis, anti, cis-linear triquinanes, starting from the readily available (S)-campholenaldehyde, employing an intramolecular rhodium carbenoid CH insertion reaction, are described. (C) 2010 Elsevier Ltd. All rights reserved.

Studies in stereochemistry—I : Stereospecific routes to trans- anti- and cis- syn-Δ8-dodecahydrophenanthrenes

Reduction of trans-1-oxo-7-methoxy-1,2,3,4,9,10,11,12-octahydrophenanthrene (XI) by lithium tri-t-butoxyaluminohydride gave trans-1β-hydroxy-7-methoxy-1,2,3,4,9,10,11,12-octahydrophenanthrene (XII) which on lithium-liquid ammonia reduction gave trans-anti-1β-hydroxy-7-oxo-Δ8(14)-dodecahydrophenanthrene (XIII). Reduction of cis-1-oxo-7-methoxy-1,2,3,4,9,10,11,12-octahydrophenanthrene (XV) by sodium borohydride gave cis-1α-hydroxy-7-methoxy-1,2,3,4,9,10,11,12-octahydrophenanthrene (XVI) which on lithium-liquid ammonia reduction gave cis-syn-1α-hydroxy-7-oxo-Δ8(14)-dodecahydrophenanthrene (XVII).

Analysis of short interproton distances in proline peptides as a guide in the interpretation of nuclear overhauser effects

The conformational dependence of interproton distances in model proline peptides has been investigated in order to facilitate interpretation of the results of Nuclear Overhauser Effect (NOE) studies on such peptides. For this purpose two model systems, namely, Ac-Pro-NHMe and Ac-Pro-X-NHMe have been chosen and used. In the former, short interproton distances detectable in NOE experiments permit a clear distinction between conformations with Pro ψ = -300 (helical region) and those in which ψ is around 1200 (polyproline region). For the latter, the variation of distances between the protons of methyl amide and the Pro ring have been studied by superimposing on the Ramachandran map in the (φ3, ψ3) plane. The results show that β-turns and non-β-turn conformations can be readily distinguished from NOE data and such long range NOEs should be detectable for specific non-β-turn conformations. NOEs involving Cβ and Cγ protons are particularly sensitive to the state of pyrrolidine ring puckering.

Beta-turns in nascent procollagen are sites of posttranslational enzymatic hydroxylation of proline

The selective hydroxylation of proline residues in nascent procollagen chains by prolyl hydroxylase (EC 1.14.11.2) can be understood in terms of the conformational feature of the -Pro-Gly-segments in linear peptides and globular proteins. The folded beta-turn conformation in such segments appears to be the conformational requirement for proline hydroxylation. The available data on the hydroxylation of native and synthetic substrates of prolyl hydroxylase are explained on the basis of the extent of beta-turn formation in them. Taken in conjunction with the conformational features of the hydroxyproline residue, our results bring out the conformational reason for the posttranslational proline hydroxylation which, it is proposed, leads to the "straightening" of the beta-turn segments into the linear triple-helical conformation.

cis-trans Enantiomerism in the Diels-Alder cycloadducts of 6-arylfulvenes with maleic anhydride: resolution of the exo adducts via the N-((1S)-1-(naphth-1-yl)ethyl)imide derivatives: assignment of the absolute configurations based on the crystal structure of an imide diastereomer

A new case of the uncommon cis-trans enantiomerism is presented. The titled anhydride adducts were prepared in good yields by the known reaction of three 6-arylfulvenes with maleic anhydride (aryl = phenyl, p-tolyl and p-anisyl). The exo adducts were converted to the corresponding imides by reaction with (1S)-1-(naphth-1-yl)ethylamine in similar to 80% yields, and the resulting diastereomeric imides separated by silica gel column chromatography. They were hydrolysed and recyclised to the chiral anhydrides, in `one-pot' with 10% NaOH-EtOH, followed by treatment with 2 M HCl, in similar to 40% yields. The titled anhydrides were thus obtained in homochiral form, in enantiomeric purities (generally) of similar to 90% as indicated by chiral HPLC. The chiral anhydrides were also converted to the corresponding imides (presumably stereospecifically), by treatment with ammonia solution in excellent yields. The crystal structure of one of the above diastereomeric imides (derived from 6-phenylfulvene) was determined, and based on the known (S)-configuration of the naphthylethylamine moiety, the `configurations' of the original anhydride adducts were assigned. (c) 2005 Elsevier Ltd. All rights reserved.