109 resultados para 147-895F
Resumo:
A multi-access scheme is proposed for handling priority-based messages in data communication systems through satellites. The different schemes by which time slots are alloted by the satellite are based on a ‘priority index’. The performance characteristics of the system using these schemes under different traffic conditions are discussed.
Resumo:
Identification of the optimum generation schedule by various methods of coordinating incremental generation costs and incremental transmission losses has been described previously in the literature. This paper presents an analytical approach which reduces the time-consuming iterative procedure into a mere positive-root determination of a third-order polynomial in λ. This approach includes the effect of transmission losses and is suitable for systems with any number of plants. The validity and effectiveness of this method are demonstrated by analysing a sample system.
Resumo:
The triplets of four cyclic enethiones, including thiocoumarin, have been investigated by nanosecond laser flash photolysis. Data are presented for transient spectra and kinetics associated with triplets, quantum yields of intersystem crossing and singlet oxygen photosensitization. The quenching of the thiocoumarin triplet (A:, = 485 nm, E:,, = 8.8 x lo3 dm3 mol-' cm-'in benzene) by several olefins, amines and hydrogen donors occurs with rate constants of 107-5 x lo9 dm3 mol-' s-'; the lower limits of quantum yields ( c#+~) for the related photoreactions, estimated from ground-state depletion, are generally small (0.0-0.1 1 in benzene, except for good hydrogen donors, namely, p-methoxythiophenol and tri-n-butylstannane) . The radical anion of thiocoumarin (A,,, = 405-435 nm) is formed in two stages upon triplet quenching by triethylamine in acetonitrile; the fast component is the result of direct electron transfer to the triplet and the slower component is assigned to secondary photoreduction of the thione ground state by the a-aminoalkyl radical derived from the triethylamine radical-cation.
Resumo:
One of the important developments in rotary wing aeroelasticity in the recent past has been the growing awareness and acceptance of the fact that the problem is inherently non-linear and that correct treatment of aeroelastic problems requires the development of a consistent mathematical model [l]. This has led to a number of studies devoted to the derivation of a consistent set of “second order” non-linear equations, for example, those of Hodges and Dowel1 [2], of Rosen and Friedmann [3], and of Kvaternik, White and Kaza [4], each of which differs from the others on the question of the inclusion of certain terms in the equations of motion. The final form of the equations depends first upon the ordering scheme used for characterizing the displacements and upon the consistency with which this is applied in omitting terms of lower order. The ideal way of achieving this would be to derive the equations of motion with all the terms first included regardless of their relative orders of magnitude and then to apply the ordering scheme.
Resumo:
Abstract is not availabe.
Resumo:
Thermal behaviour of ammonium perchlorate-aluminium composites is studied using differential thermal analysis, thermogravimetry and differential scanning calorimetry. Electrical resistivity studies throw light on the mechanism of ammonium perchlorate decomposition at different aluminium contents. The differences observed in burning behaviour by earlier authors is explained in terms of porosity and thermal conductivity of the composite.
Resumo:
The ability of a monkey antiserum to ovine LH to interrupt gestation in monkeys has been established. The antiserum has been shown to neutralize monkey pituitary LH by a number of criteria. The significant increase in serum progesterone level on day 23 of the cycle shown by mated monkeys has been used as an index of pregnancy. Injection of LH antiserum during the first week of missed menses (day 29–31 of cycle or day 18–20 of gestation) causes significant reduction in serum levels of progesterone followed by onset of bleeding which is interpreted as the termination of gestation. The same dose of non-immune serum given to monkeys during the same period does not have any deleterious effect on the progress of pregnancy. The antiserum-treated animals after the termination of gestation, resume cyclicity. Injection of antiserum after day 25 of gestation does not bring about termination of pregnancy. It is suggested that by using antisera raised in humans to ovine LH, this method may be developed as a fertility control measure in humans.
Resumo:
The porphyrogenic drug allylisopropylacetamide, a potent inducer of delta-aminolaevulinate synthetase, specifically increases nucleoplasmic RNA synthesis in rat liver. The drug-mediated increase in nucleoplasmic RNA synthesis is blocked by cycloheximide and haemin, which also inhibit the enzyme induction.
Resumo:
The quaternary system Sb1bTe1bBi1bSe with small amounts of suitable dopants is of interest for the manufacture of thermoelectric modules which exhibit the Peltier and Seebeck effects. This property could be useful in the production of energy from the thermoelectric effect. Other substances are bismuth telluride (Bi2Te3) and Sb1bTe1bBi and compounds such as ZnIn2Se4. In the present paper the application of computer programs such as MIGAP of Kaufman is used to indicate the stability of the ternary limits of Sb1bTe1bBi within the temperature ranges of interest, namely 273 K to 300 K.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
Nitrate assimilation in many plants, algae, yeasts and bacteria is mediated by two enzymes, nitrate reductase (EC 1.6.6.2) and nitrite reductase (EC 1.7.7.1). They catalyse the stepwise reduction of nitrate to nitrite and nitrite to ammonia respectively. The nitrite reductase from an industrially important yeast, Candida utilis, has been purified to homogeneity. Purified nitrite reductase is a heterodimer and the molecular masses of the two subunits are 58 and 66 kDa. The native enzyme exhibits a molecular mass of 126 kDa as analysed by gel filtration. The identify of the two subunits of nitrite reductase was confirmed by immunoblotting using antibody for Cucurbita pepo leaf nitrite reductase. The presence of two different sized transcripts coding for the two subunits was confirmed by (a) in vitro translation of mRNA from nitrate-induced C. utilis followed by immunoprecipitation of the in vitro translated products with heterologous nitrite reductase antibody and (b) Northern-blot analysis. The 66 kDa subunit is acidic in nature which is probably due to its phosphorylated status. The enzyme is stable over a range of temperatures. Both subunits can catalyse nitrite reduction, and the reconstituted enzyme, at a higher protein concentration, shows an activity similar to that of the purified enzyme. Each of these subunits has been shown to contain a few unique peptides in addition to a large number of common peptides. Reduced Methyl Viologen has been found to be as effective an electron donor as NADPH in the catalytic process, a phenomenon not commonly seen for nitrite reductases from other systems.
Resumo:
Polyhedral bodies of Bombyx mori nuclear polyhedrosis virus, BmNPV (BGL) isolated from infected silkworms around Bangalore were propagated either in the cultured B. mori cell line, BmN or through infection of larvae. Electron microscopic (EM) observations of the polyhedra revealed an average length of 2 mu m and a height of 0.5 mu m. The purified polyhedra derived virions (PDV) showed several bands in sucrose gradient centrifugation, indicating the multiple nucleocapsid nature of BmNPV. Electron microscopic studies of PDV revealed a cylindrical, rod-shaped nucleocapsid with an average length of 300 nm and a diameter of 35 nm. The genomic DNA from the PDV was characterized by extensive restriction analysis and the genome size was estimated to be 132 kb. The restriction pattern of BmNPV (BGL) resembled that of the prototype strain BmNPV-T3. Distinct differences due to polymorphic sites for restriction enzyme HindIII were apparent between BmNPV (BGL) and the virus isolated from a different part of Karnataka (Dharwad area), BmNPV (DHR).
Resumo:
Chicken riboflavin carrier protein (RCP) is a phosphoglycoprotein present in the egg white and yolk of egg-laying animals and in the sera of laying hens and of estrogenized chicks. The RCP cDNA, encoding a protein of predictedMr27,000, has been cloned into a T7 polymerase-driven vector, and high-level expression was observed on induction with IPTG inEscherichia coli.The protein was largely localized in inclusion bodies when expressed at 37°C but was present in the cytosolic fraction when induced at 22°C. At 37°C, two major bands were detected in whole-cell lysates of the strain expressing the protein. N-terminal sequence analysis indicated that the two proteins represented translated products with and without the pelB leader sequence encoded in the pET20b vector, but both included an additional 10 amino acids generated during cloning procedures. The inclusion body obtained at 37°C, on extraction with detergent, led to preferential solubilization of the protein without the pelB signal sequence. The solubilized recombinant RCP was recognized by polyclonal antisera to native RCP but radioimmunoassay revealed quantitative differences in the epitopes exhibited by the recombinant protein. Thus, sequence-specific monoclonal antibodies to chicken RCP also cross-reacted with the recombinant protein with almost equal efficiency, but antibodies which recognize conformation-dependent epitopes showed relatively reduced cross-reactivity with the recombinant protein. Polyclonal antibodies to recombinant RCP were able to recognize both the native and the denatured RCP. Administration of recombinant RCP antisera to pregnant mice led to embryonic resorption leading to early pregnancy termination. These findings reveal that the recombinant protein will be useful for investigations related to the mechanism of pregnancy termination on immunoneutralization of RCP in mammals, as well as in unraveling folding properties of RCP in terms of its ligand binding and antigenetic determinants exposed at its surface.