50 resultados para proline uptake


Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have carried out an analysis of crystal structure data on prolyl and hydroxyprolyl moieties in small molecules. The flexibility of the pyrrolidine ring due to the pyramidal character of nitrogen has been defined in terms of two projection angles δ1 and δ2. The distribution of these parameters in the crystal structures is found to be consistent with results of the energy calculations carried out on prolyl moieties in our laboratory.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A formalism for extracting the conformations of a proline ring based on the bistable jump model of R. E. London [(1978) J. Am. Chem. Soc. 100, 2678-2685] from 13C spin-lattice relaxation times (T1) is given. The method is such that the relaxation data are only partially used to generate the conformations; these conformations are constrained to satisfy the rest of the relaxation data and to yield acceptable ring geometry. An alternate equation for T1 of 13C nuclei to that of London is given. The formalism is illustrated through an example.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A model of root water extraction is proposed, in which a linear variation of extraction rate with depth is assumed. Five crops are chosen for simulation studies of the model, and soil moisture depletion under optimal conditions from different layers for each crop is calculated. Similar calculations are also made using the constant extraction rate model. Rooting depth is assumed to vary linearly with potential evapotranspiration for each crop during the vegetative phase. The calculated depletion patterns are compared with measured mean depletion patterns for each crop. It is shown that the constant extraction rate model results in large errors in the prediction of soil moisture depletion, while the proposed linear extraction rate model gives satisfactory results. Hypothetical depletion patterns predicted by the model in combination with a moisture tension-dependent sink term developed elsewhere are indicated.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Tetrapeptide sequences of the type Z-Pro-Y-X were obtained from the crystal structure data on 34 globular proteins, and used in an analysis of the positional preferences of the individual amino acid residues in the β-turn conformation. The effect of fixing proline as the second position residue in the tetrapeptide sequence was studied by comparing the data obtained on the positional preferences with the corresponding data obtained by Chou and Fasman using the Z-R-Y-X sequence, where no particular residue was fixed in any of the four positions. While, in general, several amino acid residues having relatively very high or very low preferences for specific positions were found to be common to both the Z-Pro-Y-X and Z-R-Y-X sequences, many significant differences were found between the two sets of data, which are to be attributed to specific interactions arising from the presence of the proline residue.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Free proline content in Ragi (Eleusine coracana) leaves increased markedly (6 to 85 fold) as the degree of water stress, created by polyethylene gylcol treatment, was prolonged There was also a marginal increase in soluble proteins in the stressed leaves as compared to that in the controls. Water stress stimulated the activities of ornithine aminotransferase and pyrroline-5-carboxylate reductase, the enzymes of proline biosynthesis and markedly inhibited the enzymes involved in proline degradation viz., proline oxidase and pyrroline-5-carboxylate dehydrogenase. These results suggest that increase in free proline content of Ragi leaves could be due to enhanced activities of the enzymes synthesizing proline but more importantly due to severe inhibition of the enzymes degrading proline. These observations establish for the first time, the pathway of proline metabolism in plants by way of detection of the activities of all the enzymes involved and also highlight the role of these enzymes in proline accumulation during water stress.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A Monte Carlo study along with experimental uptake measurements of 1,2,3-trimethyl benzene, 1,2,4-trimethyl benzene and 1,3,5-trimethyl benzene (TMB) in beta zeolite is reported. The TraPPE potential has been employed for hydrocarbon interaction and harmonic potential of Demontis for modeling framework of the zeolite. Structure, energetics and dynamics of TMB in zeolite beta from Monte Carlo runs reveal interesting information about the diameter, properties of these isomers on confinement. Of the three isomers, 135TMB is supposed to have the largest diameter. It is seen TraPPE with Demontis potential predicts a restricted motion of 135TMB in the channels of zeolite beta.Experimentally, 135TMB has the highest transport diffusivity whereas MID results suggest this has the lowest self diffusivity. (C) 2009 Elsevier Inc. Ail rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The transport of glycine in vitro into the silk glands of the silkworm has been studied. Glycine accumulates inside the tissue to a concentration higher than that present outside, indicating an active transport mechanism. The kinetics of uptake show a biphasic curve and two apparent Km values for accumulation, 0.33 mM and 5.00 mM. The effect of inhibitors on the energy metabolism of glycine transport is inconclusive. Exchange studies indicate the existence of two pools inside the gland, one that is easily removed by exchange and osmotic shock, and the other which is not. The results obtained conform with the carrier model of Britten and McClure concerning the amino-acid pool in E. coli.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Water stress resulted in a specific response leading to a large and significant increase (80-fold) in free proline content of ragi (Eleusine coracana) leaves and seedlings. L-Proline protected ornithine aminotransferase, an enzyme in the pathway for proline biosynthesis, isolated from normal and stressed ragi leaves against heat inactivation and denaturation by urea and guanidinium chloride. The protection of the stressed enzyme by L-proline was much more complete than that of the enzyme isolated from normal leaves. While L-ornithine, one of the substrates, protected the stressed enzyme against inactivation, it enhanced the rate of inactivation of the normal enzyme. α-Ketoglutarate protected both the normal and stressed enzyme against inactivation and denaturation. These results support the suggestion that ornithine aminotransferase has undergone a structural alteration during water stress. In view of the causal relationship between elevated temperature and water stress of plants under natural conditions, the protection afforded by proline against inactivation and denaturation of the enzyme from stressed leaves assumes significance. These results provide an explanation for a possible functional importance of proline accumulation during water stress.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

allo-4-Hydroxy-L-proline crystallizes from an aqueous solution as the dihydrate. The crystals are orthorhombic, space group P212121, with a=7.08 (2), b=22.13 (3), c= 5"20 (2) A,. The structure was solved by direct methods and refined by block-diagonal least squares. The final R for 733 observed reflexions is 0.054. The molecule exists as a zwitterion with hydroxyl and carboxyl groups cis to the pyrrolidine ring. The latter is puckered at the fl-carbon atom, which deviates by -0.54 A, from the best plane formed by the four remaining atoms. The molecules are held together by a network of hydrogen bonds, the water molecules playing a dominant role in the stability of the structure.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

"Strong" excitants of central neurones such as β N-oxalyl L α,β-diaminopropionic acid (ODAP), N-methyl-D-aspartic acid (NMDA) and kainic acid (KA) were found to inhibit the high affinity uptake of glutamate and aspartate in synaptosomes isolated from young rat brain. The potency of these "strong" excitants as convulsants appear to parallel their ability to inhibit glutamate uptake by synaptosomes. The data suggest the possibility that the convulsive effect of these "strong" excitants could be mediated by glutamate/aspartate.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

THE unusual amino acid beta-N-oxalyl-L-alpha, beta-diaminopropionic acid (ODAP), isolated from the seeds of Lathyrus sativus is a potent neurotoxin1−3. It produces biochemical changes in the brain typical of an excitant amino acid and is implicated in the aetiology of human neurolathyrism caused by eating the seeds of L. sativus 4−6. It may act as a glutamate antagonist: ODAP inhibits glutamate oxidation7 possibly by inhibiting glutamate uptake in bovine brain mitochondria; it also acts as a competitive inhibitor of glutamate uptake in certain strains of yeast8, and a similar process might occur at the synaptic level. Any effect of ODAP on glutamate uptake at synapses is significant in view of the neurotransmitter function of glutamate, which seems to be neuroexcitory as well as neurotoxic9−12. But Balcar and Johnston13 have shown with rat brain slices that ODAP does not inhibit the glutamate uptake by the high affinity system.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The pseudoproline residue (Psi Pro, L-2,2-dimethyl-1,3-thiazolidine-4-carboxylic acid) has been introduced into heterochiral diproline segments that have been previously shown to facilitate the formation of beta-hairpins, containing central two and three residue turns. NMR studies of the octapeptide Boc-Leu-Phe-Val-(D)Pro-Psi Pro-Leu-Phe-Val-OMe (1), Boc-Leu-Val-Val-(D)Pro-Psi Pro-Leu-Val-Val-OMe (2), and the nonapeptide sequence Boc-Leu-Phe-Val-(D)Pro-Psi Pro-(D)Ala-Leu-Phe-Val-OMe (3) established well-registered beta-hairpin structures in chloroform solution, with the almost exclusive population of the trans conformation for the peptide bond preceding the Psi Pro residue. The beta-hairpin conformation of 1 is confirmed by single crystal X-ray diffraction. Truncation of the strand length in Boc-Val-(D)Pro-Psi Pro-Leu-OMe (4) results in air increase in the population of the cis conformer, with a cis/trans ratio of 3.65. Replacement of Psi Pro in 4 by (L)Pro in 5, results in almost exclusive population of the trans form, resulting in an incipient beta-hairpin conformation, stabilized by two intramolecular hydrogen bonds. Further truncation of the sequence gives an appreciable rise in the population of cis conformers in the tripeptide piv-(D)Pro-Psi Pro-Leu-OMe (6). In the homochiral segment Piv-Pro Psi Pro-Leu-OMe (7) only the cis form is observed with the NMR evidence strongly supporting a type VIa beta-turn conformation, stabilized by a 4 -> 1 hydrogen bond between the Piv (CO) and Leu (3) NH groups. The crystal structure of the analog peptide 7a (Piv-Pro-Psi(H,CH3)Pro-Leu-NHMe) confirms the cis peptide bond geometry for the Pro-Psi(H,CH3)pro peptide bond, resulting in a type VIa beta-turn conformation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The 270 MHz 1H n.m.r. spectrum of benzyloxycarbonyl-Pro-N-methylamide in CDCl3 is exchange broadened at 293° K. Spectral lines due to two species are frozen out at 253° K and a dynamically averaged spectrum is obtained at 323° K. A selective broadening of the Cβ and Cγ resonances in the 13C n.m.r. spectrum is observed at 253° K, with a splitting of the Cβ and Cγ resonances into a pair of lines of unequal intensity. A similar broadening of Cβ and Cγ peaks is also detected in pivaloyl-Pro-N-methylamide where cis-trans interconversion about the imide bond is precluded by the bulky t-butyl group. The rate process is thus attributed to rotation about the Cα-CO bond (ψ) and a barrier (ΔG#) of 14kcal mol-1 is estimated. 13C n.m.r. data for pivaloyl-Pro-N-methylamide in a number of solvents is presented and the differences in the Cβ and Cγ chemical shifts are interpreted in terms of rotational isomerism about the Cα-CO bond.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The stepwise synthesis of amino terminal pentapeptide of alamethicin, Z-Aib-Pro-Aib-Ala-Aib-OMe, by the dicyclohexylcarbodiimide mediated couplings leads to extensive racemization at the Ala and Pro residues. Racemization is largely suppressed by the use of additives like N-hydroxysuccinimide and 1-hydroxybenzotriazole. The presence of diastereomeric peptides may be detected by the observation of additional methyl ester and benzylic methylene signals in the 270 MHz 1H NMR spectra. Unambiguous spectral assignment of the signals to the diastereomers has been carried out by the synthesis and NMR studies of the D-Ala tetra and pentapeptides. The racemization at Pro is of particular relevance in view of the reported lack of inversion at C-terminal Pro on carboxyl activation.