4 resultados para strong electronic excitation effect
em National Center for Biotechnology Information - NCBI
Resumo:
The electronic excitations of naphthalene and a family of bridged naphthalene dimers are calculated and analyzed by using the Collective Electronic Oscillator method combined with the oblique Lanczos algorithm. All experimentally observed trends in absorption profiles and radiative lifetimes are reproduced. Each electronic excitation is linked to the corresponding real-space transition density matrix, which represents the motions of electrons and holes created in the molecule by photon absorption. Two-dimensional plots of these matrices help visualize the degree of exciton localization and explain the dependence of the electronic interaction between chromophores on their separation.
Resumo:
A new and sensitive molecular probe, 2-(2′-hydroxyphenyl)imidazo[1,2-a]pyridine (HPIP), for monitoring structural changes in lipid bilayers is presented. Migration of HPIP from water into vesicles involves rupture of hydrogen (H) bonds with water and formation of an internal H bond once the probe is inside the vesicle. These structural changes of the dye allow the occurrence of a photoinduced intramolecular proton-transfer reaction and a subsequent twisting/rotational process upon electronic excitation of the probe. The resulting large Stokes-shifted fluorescence band depends on the twisting motion of the zwitterionic phototautomer and is characterized in vesicles of dimyristoyl-phosphatidylcholine and in dipalmitoyl-phosphatidylcholine at the temperature range of interest and in the presence of cholesterol. Because the fluorescence of aqueous HPIP does not interfere in the emission of the probe within the vesicles, HPIP proton-transfer/twisting motion fluorescence directly allows us to monitor and quantify structural changes within bilayers. The static and dynamic fluorescence parameters are sensitive enough to such changes to suggest this photostable dye as a potential molecular probe of the physical properties of lipid bilayers.
Resumo:
Photosynthetic organisms fuel their metabolism with light energy and have developed for this purpose an efficient apparatus for harvesting sunlight. The atomic structure of the apparatus, as it evolved in purple bacteria, has been constructed through a combination of x-ray crystallography, electron microscopy, and modeling. The detailed structure and overall architecture reveals a hierarchical aggregate of pigments that utilizes, as shown through femtosecond spectroscopy and quantum physics, elegant and efficient mechanisms for primary light absorption and transfer of electronic excitation toward the photosynthetic reaction center.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.