4 resultados para retardation factor
em National Center for Biotechnology Information - NCBI
Resumo:
We previously isolated the SKN7 gene in a screen designed to isolate new components of the G1-S cell cycle transcription machinery in budding yeast. We have now found that Skn7 associates with Mbp1, the DNA-binding component of the G1-S transcription factor DSC1/MBF. SKN7 and MBP1 show several genetic interactions. Skn7 overexpression is lethal and is suppressed by a mutation in MBP1. Similarly, high overexpression of Mbp1 is lethal and can be suppressed by skn7 mutations. SKN7 is also required for MBP1 function in a mutant compromised for G1-specific transcription. Gel-retardation assays indicate that Skn7 is not an integral part of MBF. However, a physical interaction between Skn7 and Mbp1 was detected using two-hybrid assays and GST pulldowns. Thus, Skn7 and Mbp1 seem to form a transcription factor independent of MBF. Genetic data suggest that this new transcription factor could be involved in the bud-emergence process.
Resumo:
Tumor necrosis factor-related, activation-induced cytokine (TRANCE), a tumor necrosis factor family member, mediates survival of dendritic cells in the immune system and is required for osteoclast differentiation and activation in the skeleton. We report the skeletal phenotype of TRANCE-deficient mice and its rescue by the TRANCE transgene specifically expressed in lymphocytes. TRANCE-deficient mice showed severe osteopetrosis, with no osteoclasts, marrow spaces, or tooth eruption, and exhibited profound growth retardation at several skeletal sites, including the limbs, skull, and vertebrae. These mice had marked chondrodysplasia, with thick, irregular growth plates and a relative increase in hypertrophic chondrocytes. Transgenic overexpression of TRANCE in lymphocytes of TRANCE-deficient mice rescued osteoclast development in two locations in growing long bones: excavation of marrow cavities permitting hematopoiesis in the marrow spaces, and remodeling of osteopetrotic woven bone in the shafts of long bones into histologically normal lamellar bone. However, osteoclasts in these mice failed to appear at the chondroosseous junction and the metaphyseal periosteum of long bones, nor were they present in tooth eruption pathways. These defects resulted in sclerotic metaphyses with persistence of club-shaped long bones and unerupted teeth, and the growth plate defects were largely unimproved by the TRANCE transgene. Thus, TRANCE-mediated regulation of the skeleton is complex, and impacts chondrocyte differentiation and osteoclast formation in a manner that likely requires local delivery of TRANCE.
Resumo:
Kindling, an animal model of epilepsy wherein seizures are induced by subcortical electrical stimulation, results in the upregulation of neurotrophin mRNA and protein in the adult rat forebrain and causes mossy fiber sprouting in the hippocampus. Intraventricular infusion of a synthetic peptide mimic of a nerve growth factor domain that interferes with the binding of neurotrophins to their receptors resulted in significant retardation of kindling and inhibition of mossy fiber sprouting. These findings suggest a critical role for neurotrophins in both kindling and kindling-induced synaptic reorganization.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.