19 resultados para clinical (human) or epidemiologic studies : risk factor assessment

em National Center for Biotechnology Information - NCBI


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The granulocyte-macrophage colony-stimulating factor (GM-CSF) gene is part of a cytokine gene cluster and is directly linked to a conserved upstream inducible enhancer. Here we examined the in vitro and in vivo functions of the human GM-CSF enhancer and found that it was required for the correctly regulated expression of the GM-CSF gene. An inducible DNase I-hypersensitive site appeared within the enhancer in cell types such as T cells, myeloid cells, and endothelial cells that express GM-CSF, but not in nonexpressing cells. In a panel of transfected cells the human GM-CSF enhancer was activated in a tissue-specific manner in parallel with the endogenous gene. The in vivo function of the enhancer was examined in a transgenic mouse model that also addressed the issue of whether the GM-CSF locus was correctly regulated in isolation from other segments of the cytokine gene cluster. After correction for copy number the mean level of human GM-CSF expression in splenocytes from 11 lines of transgenic mice containing a 10.5-kb human GM-CSF transgene was indistinguishable from mouse GM-CSF expression (99% ± 56% SD). In contrast, a 9.8-kb transgene lacking just the enhancer had a significantly reduced (P = 0.004) and more variable level of activity (29% ± 89% SD). From these studies we conclude that the GM-CSF enhancer is required for the correct copy number-dependent expression of the human GM-CSF gene and that the GM-CSF gene is regulated independently from DNA elements associated with the closely linked IL-3 gene or other members of the cytokine gene cluster.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The TATA-binding protein (TBP)-related factor TRF1, has been described in Drosophila and a related protein, TRF2, has been found in a variety of higher eukaryotes. We report that human (h)TRF2 is encoded by two mRNAs with common protein coding but distinct 5′ nontranslated regions. One mRNA is expressed ubiquitously (hTRF2-mRNA1), whereas the other (hTRF2-mRNA2) shows a restricted expression pattern and is extremely abundant in testis. In addition, we show that hTRF2 forms a stable stoichiometric complex with hTFIIA, but not with TAFs, in HeLa cells stably transfected with flag-tagged hTRF2. Neither recombinant human (rh)TRF2 nor the native flag⋅hTRF2-TFIIA complex is able to replace TBP or TFIID in basal or activated transcription from various RNA polymerase II promoters. Instead, rhTRF2, but not the flag⋅hTRF2–TFIIA complex, moderately inhibits basal or activated transcription in the presence of rhTBP or flag⋅TFIID. This effect is either completely (TBP-mediated transcription) or partially (TFIID-mediated transcription) counteracted by addition of free TFIIA. Neither rhTRF2 nor flag⋅hTRF2–TFIIA has any effect on the repression of TFIID-mediated transcription by negative cofactor-2 (NC2) and neither substitutes for TBP in RNA polymerase III-mediated transcription.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Objective: To explore the usefulness of epidemiological data to guide clinical practice by seeking an answer to the question “What is the risk of cardiovascular disease among users of currently available, low dose, combined oral contraceptives who are aged less than 35 years, do not smoke, and do not have a medical condition known to increase the risk of vascular disease?”

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Interstitial pneumonia is characterized by alveolitis with resulting fibrosis of the interstitium. To determine the relevance of humoral factors in the pathogenesis of interstitial pneumonia, we introduced expression vectors into Wistar rats via the trachea to locally overexpress humoral factors in the lungs. Human interleukin (IL) 6 and IL-6 receptor genes induced lymphocytic alveolitis without marked fibroblast proliferation. In contrast, overexpression of human transforming growth factor beta 1 or human platelet-derived growth factor B gene induced only mild or apparent cellular infiltration in the alveoli, respectively. However, both factors induced significant proliferation of fibroblasts and deposition of collagen fibrils. These histopathologic changes induced by the transforming growth factor beta 1 and platelet-derived growth factor B gene are partly akin to those changes seen in lung tissues from patients with pulmonary fibrosis and markedly contrast with the changes induced by overexpression of the IL-6 and IL-6 receptor genes that mimics lymphocytic interstitial pneumonia.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

RB, the protein product of the retinoblastoma tumor-suppressor gene, regulates the activity of specific transcription factors. This regulation appears to be mediated either directly through interactions with specific transcription factors or through an alternative mechanism. Here we report that stimulation of Sp1-mediated transcription by RB is partially abrogated at the nonpermissive temperature in ts13 cells. These cells contain a temperature-sensitive mutation in the TATA-binding protein-associated factor TAFII250, first identified as the cell cycle regulatory protein CCG1. The stimulation of Sp1-mediated transcription by RB in ts13 cells at the nonpermissive temperature could be restored by the introduction of wild-type human TAFII250. Furthermore, we demonstrate that RB binds directly to hTAFII250 in vitro and in vivo. These results suggest that RB can confer transcriptional regulation and possibly cell cycle control and tumor suppression through an interaction with TFIID, in particular with TAFII250.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Eukaryotic translation initiation factor 6 (eIF6) binds to the 60S ribosomal subunit and prevents its association with the 40S ribosomal subunit. In this paper, we devised a procedure for purifying eIF6 from rabbit reticulocyte lysates and immunochemically characterized the protein by using antibodies isolated from egg yolks of laying hens immunized with rabbit eIF6. By using these monospecific antibodies, a 1.096-kb human cDNA that encodes an eIF6 of 245 amino acids (calculated Mr 26,558) has been cloned and expressed in Escherichia coli. The purified recombinant human protein exhibits biochemical properties that are similar to eIF6 isolated from mammalian cell extracts. Database searches identified amino acid sequences from Saccharomyces cerevisiae, Drosophila, and the nematode Caenorhabditis elegans with significant identity to the deduced amino acid sequence of human eIF6, suggesting the presence of homologues of human eIF6 in these organisms.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Objective: To determine the relation between depression, anxiety, and use of antidepressants and the onset of ischaemic heart disease.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Objective: To clarify the extent to which working hours affect the risk of acute myocardial infarction, independent of established risk factors and occupational conditions.