Correction of murine galactosialidosis by bone marrow-derived macrophages overexpressing human protective protein/cathepsin A under control of the colony-stimulating factor-1 receptor promoter

Galactosialidosis (GS) is a human neurodegenerative disease caused by a deficiency of lysosomal protective protein/cathepsin A (PPCA). The GS mouse model resembles the severe human condition, resulting in nephropathy, ataxia, and premature death. To rescue the disease phenotype, GS mice were transplanted with bone marrow from transgenic mice overexpressing human PPCA specifically in monocytes/macrophages under the control of the colony stimulating factor-1 receptor promoter. Transgenic macrophages infiltrated and resided in all organs and expressed PPCA at high levels. Correction occurred in hematopoietic tissues and nonhematopoietic organs, including the central nervous system. PPCA-expressing perivascular and leptomeningeal macrophages were detected throughout the brain of recipient mice, although some neuronal cells, such as Purkinje cells, continued to show storage and died. GS mice crossed into the transgenic background reflected the outcome of bone marrow-transplanted mice, but the course of neuronal degeneration was delayed in this model. These studies present definite evidence that macrophages alone can provide a source of corrective enzyme for visceral organs and may be beneficial for neuronal correction if expression levels are sufficient.

Proviral insertions induce the expression of bone-specific isoforms of PEBP2αA (CBFA1): Evidence for a new myc collaborating oncogene

The til-1 locus was identified as a common retroviral integration site in virus-accelerated lymphomas of CD2-myc transgenic mice. We now show that viral insertions at til-1 lead to transcriptional activation of PEBP2αA (CBFA1), a transcription factor related to the Drosophila segmentation gene product, Runt. Insertions are upstream and in the opposite orientation to the gene and appear to activate a variant promoter that is normally silent in T cells. Activity of this promoter was detected in rodent osteogenic sarcoma cells and primary osteoblasts, implicating bone as the normal site of promoter activity. The isoforms encoded by the activated gene all encompass the conserved runt DNA-binding domain and share a novel N terminus different from the previously reported PEBP2αA products. Minor products include isoforms with internal deletions due to exon skipping and a novel C-terminal domain unrelated to known runt domain factors. The major isoform expressed from the activated til-1 locus (G1) was found to account for virtually all of the core binding factor activity in nuclear extracts from its corresponding lymphoma cell line. Another member of this gene family, AML1(CBFA2), is well known for its involvement in human hemopoietic tumors. These results provide evidence of a direct oncogenic role for PEBP2αA and indicate that the Myc and Runt family genes can cooperate in oncogenesis.

Cloning and characterization of the mouse vitamin D receptor promoter

The gene encoding the mouse vitamin D receptor has been cloned. A new exon 1 has been found that changes the numbering established for the human VDR gene. Exons 2 and 3 in the human VDR gene (coding for the zinc fingers 1 and 2, respectively) are named exons 3 and 4 in the mouse vitamin D receptor. The 1.5-kb 5′-flanking region of the new exon 1 was analyzed and revealed the presence of putative cis-acting elements. Despite the absence of a TATA box, this 5′-flanking region contains several characteristics of a GC-rich promoter including four Sp1 sites present in tandem and two CCAAT boxes. Interestingly, the Sp1 site that is the most proximal to the new exon 1 overlaps a perfect site for Krox-20/24. Krox-20 is a transcription factor involved in brain development, and also in bone remodeling. In luciferase reporter gene expression assays, we showed that sequences from this 5′-flanking region elicit high transactivation activity. Furthermore, in the NIH 3T3 cell line, a 3- to 5-fold increase in response to forskolin treatment (an activator of adenylate cyclase and in turn of protein kinase A pathway) was observed.

Preselection of retrovirally transduced bone marrow avoids subsequent stem cell gene silencing and age-dependent extinction of expression of human β-globin in engrafted mice

Transcriptional silencing of genes transferred into hematopoietic stem cells poses one of the most significant challenges to the success of gene therapy. If the transferred gene is not completely silenced, a progressive decline in gene expression as the mice age often is encountered. These phenomena were observed to various degrees in mouse transplant experiments using retroviral vectors containing a human β-globin gene, even when cis-linked to locus control region derivatives. Here, we have investigated whether ex vivo preselection of retrovirally transduced stem cells on the basis of expression of the green fluorescent protein driven by the CpG island phosphoglycerate kinase promoter can ensure subsequent long-term expression of a cis-linked β-globin gene in the erythroid lineage of transplanted mice. We observed that 100% of mice (n = 7) engrafted with preselected cells concurrently expressed human β-globin and the green fluorescent protein in 20–95% of their RBC for up to 9.5 mo posttransplantation, the longest time point assessed. This expression pattern was successfully transferred to secondary transplant recipients. In the presence of β-locus control region hypersensitive site 2 alone, human β-globin mRNA expression levels ranged from 0.15% to 20% with human β-globin chains detected by HPLC. Neither the proportion of positive blood cells nor the average expression levels declined with time in transplanted recipients. Although suboptimal expression levels and heterocellular position effects persisted, in vivo stem cell gene silencing and age-dependent extinction of expression were avoided. These findings support the further investigation of this type of vector for the gene therapy of human hemoglobinopathies.

Targeted expression of constitutively active receptors for parathyroid hormone and parathyroid hormone-related peptide delays endochondral bone formation and rescues mice that lack parathyroid hormone-related peptide

Mice in which the genes encoding the parathyroid hormone (PTH)-related peptide (PTHrP) or the PTH/PTHrP receptor have been ablated by homologous recombination show skeletal dysplasia due to accelerated endochondral bone formation, and die at birth or in utero, respectively. Skeletal abnormalities due to decelerated chondrocyte maturation are observed in transgenic mice where PTHrP expression is targeted to the growth plate, and in patients with Jansen metaphyseal chondrodysplasia, a rare genetic disorder caused by constitutively active PTH/PTHrP receptors. These and other findings thus indicate that PTHrP and its receptor are essential for chondrocyte differentiation. To further explore the role of the PTH/PTHrP receptor in this process, we generated transgenic mice in which expression of a constitutively active receptor, HKrk-H223R, was targeted to the growth plate by the rat α1 (II) collagen promoter. Two major goals were pursued: (i) to investigate how constitutively active PTH/PTHrP receptors affect the program of chondrocyte maturation; and (ii) to determine whether expression of the mutant receptor would correct the severe growth plate abnormalities of PTHrP-ablated mice (PTHrP−/−). The targeted expression of constitutively active PTH/PTHrP receptors led to delayed mineralization, decelerated conversion of proliferative chondrocytes into hypertrophic cells in skeletal segments that are formed by the endochondral process, and prolonged presence of hypertrophic chondrocytes with delay of vascular invasion. Furthermore, it corrected at birth the growth plate abnormalities of PTHrP−/− mice and allowed their prolonged survival. “Rescued” animals lacked tooth eruption and showed premature epiphyseal closure, indicating that both processes involve PTHrP. These findings suggest that rescued PTHrP−/− mice may gain considerable importance for studying the diverse, possibly tissue-specific role(s) of PTHrP in postnatal development.

Synergistic up-regulation of the myeloid-specific promoter for the macrophage colony-stimulating factor receptor by AML1 and the t(8;21) fusion protein may contribute to leukemogenesis.

AML1 is involved in the (8;21) translocation, associated with acute myelogenous leukemia (AML)-type M2, which results in the production of the AML1-ETO fusion protein: the amino-terminal 177 amino acids of AML1 and the carboxyl-terminal 575 amino acids of ETO. The mechanism by which AML1-ETO accomplishes leukemic transformation is unknown; however, AML1-ETO interferes with AML1 transactivation of such AML1 targets as the T-cell receptor beta enhancer and the granulocyte-macrophage colony-stimulating factor promoter. Herein, we explored the effect of AML1-ETO on regulation of a myeloid-specific AML1 target, the macrophage colony-stimulating factor (M-CSF) receptor promoter. We found that AML1-ETO and AML1 work synergistically to transactivate the M-CSF receptor promoter, thus exhibiting a different activity than previously described. Truncation mutants within the ETO portion of AML1-ETO revealed the region of ETO necessary for the cooperativity between AML1 and AML1-ETO lies between amino acids 347 and 540. Endogenous M-CSF receptor expression was examined in Kasumi-1 cells, derived from a patient with AML-M2 t(8;21) and the promonocytic cell line U937. Kasumi-1 cells exhibited a significantly higher level of M-CSF receptor expression than U937 cells. Bone marrow from patients with AML-M2 t(8;21) also exhibited a higher level of expression of M-CSF receptor compared with normal controls. The upregulation of M-CSF receptor expression by AML1-ETO may contribute to the development of a leukemic state in these patients.

Targeted overexpression of parathyroid hormone-related peptide in chondrocytes causes chondrodysplasia and delayed endochondral bone formation.

Parathyroid hormone-related peptide (PTHrP) was initially identified as a product of malignant tumors that mediates paraneoplastic hypercalcemia. It is now known that the parathyroid hormone (PTH) and PTHrP genes are evolutionarily related and that the products of these two genes share a common receptor, the PTH/PTHrP receptor. PTHrP and the PTH/PTHrP receptor are widely expressed in both adult and fetal tissues, and recent gene-targeting and disruption experiments have implicated PTHrP as a developmental regulatory molecule. Apparent PTHrP functions include the regulation of endochondral bone development, of hair follicle formation, and of branching morphogenesis in the breast. Herein, we report that overexpression of PTHrP in chondrocytes using the mouse type II collagen promoter induces a novel form of chondrodysplasia characterized by short-limbed dwarfism and a delay in endochondral ossification. This features a delay in chondrocyte differentiation and in bone collar formation and is sufficiently marked that the mice are born with a cartilaginous endochondral skeleton. In addition to the delay, chondrocytes in the transgenic mice initially become hypertrophic at the periphery of the developing long bones rather than in the middle, leading to a seeming reversal in the pattern of chondrocyte differentiation and ossification. By 7 weeks, the delays in chondrocyte differentiation and ossification have largely corrected, leaving foreshortened and misshapen but histologically near-normal bones. These findings confirm a role for PTHrP as an inhibitor of the program of chondrocyte differentiation. PTHrP may function in this regard to maintain the stepwise differentiation of chondrocytes that initiates endochondral ossification in the midsection of endochondral bones early in development and that also permits linear growth at the growth plate later in development.

Increasing DNA repair methyltransferase levels via bone marrow stem cell transduction rescues mice from the toxic effects of 1,3-bis(2-chloroethyl)-1-nitrosourea, a chemotherapeutic alkylating agent.

The chloroethylnitrosourea (CNU) alkylating agents are commonly used for cancer chemotherapy, but their usefulness is limited by severe bone marrow toxicity that causes the cumulative depletion of all hematopoietic lineages (pancytopenia). Bone marrow CNU sensitivity is probably due to the inefficient repair of CNU-induced DNA damage; relative to other tissues, bone marrow cells express extremely low levels of the O6-methylguanine DNA methyltransferase (MGMT) protein that repairs cytotoxic O6-chloroethylguanine DNA lesions. Using a simplified recombinant retroviral vector expressing the human MGMT gene under control of the phosphoglycerate kinase promoter (PGK-MGMT) we increased the capacity of murine bone marrow-derived cells to repair CNU-induced DNA damage. Stable reconstitution of mouse bone marrow with genetically modified, MGMT-expressing hematopoietic stem cells conferred considerable resistance to the cytotoxic effects of 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU), a CNU commonly used for chemotherapy. Bone marrow harvested from mice transplanted with PGK-MGMT-transduced cells showed extensive in vitro BCNU resistance. Moreover, MGMT expression in mouse bone marrow conferred in vivo resistance to BCNU-induced pancytopenia and significantly reduced BCNU-induced mortality due to bone marrow hypoplasia. These data demonstrate that increased DNA alkylation repair in primitive hematopoietic stem cells confers multilineage protection from the myelosuppressive effects of BCNU and suggest a possible approach to protecting cancer patients from CNU chemotherapy-related toxicity.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.