Chemical chaperones mediate increased secretion of mutant α1-antitrypsin (α1-AT) Z: A potential pharmacological strategy for prevention of liver injury and emphysema in α1-AT deficiency

In α1-AT deficiency, a misfolded but functionally active mutant α1-ATZ (α1-ATZ) molecule is retained in the endoplasmic reticulum of liver cells rather than secreted into the blood and body fluids. Emphysema is thought to be caused by the lack of circulating α1-AT to inhibit neutrophil elastase in the lung. Liver injury is thought to be caused by the hepatotoxic effects of the retained α1-ATZ. In this study, we show that several “chemical chaperones,” which have been shown to reverse the cellular mislocalization or misfolding of other mutant plasma membrane, nuclear, and cytoplasmic proteins, mediate increased secretion of α1-ATZ. In particular, 4-phenylbutyric acid (PBA) mediated a marked increase in secretion of functionally active α1-ATZ in a model cell culture system. Moreover, oral administration of PBA was well tolerated by PiZ mice (transgenic for the human α1-ATZ gene) and consistently mediated an increase in blood levels of human α1-AT reaching 20–50% of the levels present in PiM mice and normal humans. Because clinical studies have suggested that only partial correction is needed for prevention of both liver and lung injury in α1-AT deficiency and PBA has been used safely in humans, it constitutes an excellent candidate for chemoprophylaxis of target organ injury in α1-AT deficiency.

Gβ5 prevents the RGS7-Gαo interaction through binding to a distinct Gγ-like domain found in RGS7 and other RGS proteins

The G protein β subunit Gβ5 deviates significantly from the other four members of Gβ-subunit family in amino acid sequence and subcellular localization. To detect the protein targets of Gβ5 in vivo, we have isolated a native Gβ5 protein complex from the retinal cytosolic fraction and identified the protein tightly associated with Gβ5 as the regulator of G protein signaling (RGS) protein, RGS7. Here we show that complexes of Gβ5 with RGS proteins can be formed in vitro from the recombinant proteins. The reconstituted Gβ5-RGS dimers are similar to the native retinal complex in their behavior on gel-filtration and cation-exchange chromatographies and can be immunoprecipitated with either anti-Gβ5 or anti-RGS7 antibodies. The specific Gβ5-RGS7 interaction is determined by a distinct domain in RGS that has a striking homology to Gγ subunits. Deletion of this domain prevents the RGS7-Gβ5 binding, although the interaction with Gα is retained. Substitution of the Gγ-like domain of RGS7 with a portion of Gγ1 changes its binding specificity from Gβ5 to Gβ1. The interaction of Gβ5 with RGS7 blocked the binding of RGS7 to the Gα subunit Gαo, indicating that Gβ5 is a specific RGS inhibitor.

Myozenin: An α-actinin- and γ-filamin-binding protein of skeletal muscle Z lines

To better understand the structure and function of Z lines, we used sarcomeric isoforms of α-actinin and γ-filamin to screen a human skeletal muscle cDNA library for interacting proteins by using the yeast two-hybrid system. Here we describe myozenin (MYOZ), an α-actinin- and γ-filamin-binding Z line protein expressed predominantly in skeletal muscle. Myozenin is predicted to be a 32-kDa, globular protein with a central glycine-rich domain flanked by α-helical regions with no strong homologies to any known genes. The MYOZ gene has six exons and maps to human chromosome 10q22.1-q22.2. Northern blot analysis demonstrated that this transcript is expressed primarily in skeletal muscle with significantly lower levels of expression in several other tissues. Antimyozenin antisera stain skeletal muscle in a sarcomeric pattern indistinguishable from that seen by using antibodies for α-actinin, and immunogold electron microscopy confirms localization specifically to Z lines. Thus, myozenin is a skeletal muscle Z line protein that may be a good candidate gene for limb-girdle muscular dystrophy or other neuromuscular disorders.

The universe at z > 5: When and how did the “dark age” end?

This paper considers how the first subgalactic structures produced the UV radiation that ionized the intergalactic medium before z = 5 and the “feedback” effects of the UV radiation on structure formation. The first “pregalaxies” may eventually be detectable by their direct UV emission, with characteristic spectral features at Lyman α; high-z supernovae may also be detectable. Other probes of the intergalactic medium beyond z = 5, and of the epochs of reheating and reionization, are discussed, along with possible links between the diffusion of pregalactic metals and the origin of magnetic fields.

Contactus adherens, a special type of plaque-bearing adhering junction containing M-cadherin, in the granule cell layer of the cerebellar glomerulus.

In the glomeruli of the granule cell layer of mammalian cerebellum, neuronal extensions are interconnected by numerous small, nearly isodiametric (diameters up to 0.1 micron), junctions previously classified as puncta adherentia related to the vinculin-containing, actin microfilament-anchoring junctions of the zonula adherens of epithelial and certain other cells. Using immunofluorescence and immunoelectron microscopy, we have found, however, that these junctions are negative for E- and VE-cadherin, for desmosomal cadherins, and also for vinculin, alpha-actinin, and desmoplakin, but they do contain, in addition to the protein plakoglobin common to all forms of adhering junctions, the plaque proteins alpha- and beta-catenin and the transmembrane glycoprotein M-cadherin previously found as a spread--i.e., not junction bound--plasma membrane protein in certain fetal and regenerating muscle cells and in satellite cells of adult skeletal muscle. We conclude that these M-cadherin-containing junctions of the granule cell layer represent a special type of adhering junction, for which we propose the term contactus adherens (from the Latin contactus, for touch, site of bordering upon, also influence), and we discuss the differences between the various adhering junctions on the basis of their molecular constituents.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.