4 resultados para Seeing the other
em National Center for Biotechnology Information - NCBI
Resumo:
The suppressor of Hairy-wing [su(Hw)] protein exerts a polar effect on gene expression by repressing the function of transcriptional enhancers located distally from the promoter with respect to the location of su(Hw) binding sequences. The directionality of this effect suggests that the su(Hw) protein specifically interferes with the basic mechanism of enhancer action. Moreover, mutations in modifier of mdg4 [mod(mdg4)] result in the repression of expression of a gene when the su(Hw) protein is bound to sequences in the copy of this gene located in the homologous chromosome. This effect is dependent on the presence of the su(Hw) binding region from the gypsy retrotransposon in at least one of the chromosomes and is enhanced by the presence of additional gypsy sequences in the other homology. This phenomenon is inhibited by chromosomal rearrangements that disrupt pairing, suggesting that close apposition between the two copies of the affected gene is important for trans repression of transcription. These results indicate that, in the absence of mod-(mdg4) product, the su(Hw) protein present in one chromosome can act in trans and inactivate enhancers located in the other homolog.
Resumo:
The G protein β subunit Gβ5 deviates significantly from the other four members of Gβ-subunit family in amino acid sequence and subcellular localization. To detect the protein targets of Gβ5 in vivo, we have isolated a native Gβ5 protein complex from the retinal cytosolic fraction and identified the protein tightly associated with Gβ5 as the regulator of G protein signaling (RGS) protein, RGS7. Here we show that complexes of Gβ5 with RGS proteins can be formed in vitro from the recombinant proteins. The reconstituted Gβ5-RGS dimers are similar to the native retinal complex in their behavior on gel-filtration and cation-exchange chromatographies and can be immunoprecipitated with either anti-Gβ5 or anti-RGS7 antibodies. The specific Gβ5-RGS7 interaction is determined by a distinct domain in RGS that has a striking homology to Gγ subunits. Deletion of this domain prevents the RGS7-Gβ5 binding, although the interaction with Gα is retained. Substitution of the Gγ-like domain of RGS7 with a portion of Gγ1 changes its binding specificity from Gβ5 to Gβ1. The interaction of Gβ5 with RGS7 blocked the binding of RGS7 to the Gα subunit Gαo, indicating that Gβ5 is a specific RGS inhibitor.
Resumo:
When the visual (striate) cortex (V1) is damaged in human subjects, cortical blindness results in the contralateral visual half field. Nevertheless, under some experimental conditions, subjects demonstrate a capacity to make visual discriminations in the blind hemifield (blindsight), even though they have no phenomenal experience of seeing. This capacity must, therefore, be mediated by parallel projections to other brain areas. It is also the case that some subjects have conscious residual vision in response to fast moving stimuli or sudden changes in light flux level presented to the blind hemifield, characterized by a contentless kind of awareness, a feeling of something happening, albeit not normal seeing. The relationship between these two modes of discrimination has never been studied systematically. We examine, in the same experiment, both the unconscious discrimination and the conscious visual awareness of moving stimuli in a subject with unilateral damage to V1. The results demonstrate an excellent capacity to discriminate motion direction and orientation in the absence of acknowledged perceptual awareness. Discrimination of the stimulus parameters for acknowledged awareness apparently follows a different functional relationship with respect to stimulus speed, displacement, and stimulus contrast. As performance in the two modes can be quantitatively matched, the findings suggest that it should be possible to image brain activity and to identify the active areas involved in the same subject performing the same discrimination task, both with and without conscious awareness, and hence to determine whether any structures contribute uniquely to conscious perception.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.