Oral tolerance in myelin basic protein T-cell receptor transgenic mice: suppression of autoimmune encephalomyelitis and dose-dependent induction of regulatory cells.

Orally administered antigens induce a state of immunologic hyporesponsiveness termed oral tolerance. Different mechanisms are involved in mediating oral tolerance depending on the dose fed. Low doses of antigen generate cytokine-secreting regulatory cells, whereas high doses induce anergy or deletion. We used mice transgenic for a T-cell receptor (TCR) derived from an encephalitogenic T-cell clone specific for the acetylated N-terminal peptide of myelin basic protein (MBP) Ac-1-11 plus I-Au to test whether a regulatory T cell could be generated from the same precursor cell as that of an encephalitogenic Th1 cell and whether the induction was dose dependent. The MBP TCR transgenic mice primarily have T cells of a precursor phenotype that produce interleukin 2 (IL-2) with little interferon gamma (IFN-gamma), IL-4, or transforming growth factor beta (TGF-beta). We fed transgenic animals a low-dose (1 mg x 5) or high-dose (25 mg x 1) regimen of mouse MBP and without further immunization spleen cells were tested for cytokine production. Low-dose feeding induced prominent secretion of IL-4, IL-10, and TGF-beta, whereas minimal secretion of these cytokines was observed with high-dose feeding. Little or no change was seen in proliferation or IL-2/IFN-gamma secretion in fed animals irrespective of the dose. To demonstrate in vivo functional activity of the cytokine-secreting cells generated by oral antigen, spleen cells from low-dose-fed animals were adoptively transferred into naive (PLJ x SJL)F1 mice that were then immunized for the development of experimental autoimmune encephalomyelitis (EAE). Marked suppression of EAE was observed when T cells were transferred from MBP-fed transgenic animals but not from animals that were not fed. In contrast to oral tolerization, s.c. immunization of transgenic animals with MBP in complete Freund's adjuvant induced IFN-gamma-secreting Th1 cells in vitro and experimental encephalomyelitis in vivo. Despite the large number of cells reactive to MBP in the transgenic animals, EAE was also suppressed by low-dose feeding of MBP prior to immunization. These results demonstrate that MBP-specific T cells can differentiate in vivo into encephalitogenic or regulatory T cells depending upon the context by which they are exposed to antigen.

T cell vaccination induces T cell receptor Vβ-specific Qa-1-restricted regulatory CD8+ T cells

Vaccination of mice with activated autoantigen-reactive CD4+ T cells (T cell vaccination, TCV) has been shown to induce protection from the subsequent induction of a variety of experimental autoimmune diseases, including experimental allergic encephalomyelitis (EAE). Although the mechanisms involved in TCV-mediated protection are not completely known, there is some evidence that TCV induces CD8+ regulatory T cells that are specific for pathogenic CD4+ T cells. Previously, we demonstrated that, after superantigen administration in vivo, CD8+ T cells emerge that preferentially lyse and regulate activated autologous CD4+ T cells in a T cell receptor (TCR) Vβ-specific manner. This TCR Vβ-specific regulation is not observed in β2-microglobulin-deficient mice and is inhibited, in vitro, by antibody to Qa-1. We now show that similar Vβ8-specific Qa-1-restricted CD8+ T cells are also induced by TCV with activated CD4+ Vβ8+ T cells. These CD8+ T cells specifically lyse murine or human transfectants coexpressing Qa-1 and murine TCR Vβ8. Further, CD8+ T cell hybridoma clones generated from B10.PL mice vaccinated with a myelin basic protein-specific CD4+Vβ8+ T cell clone specifically recognize other CD4+ T cells and T cell tumors that express Vβ8 and the syngeneic Qa-1a but not the allogeneic Qa-1b molecule. Thus, Vβ-specific Qa-1-restricted CD8+ T cells are induced by activated CD4+ T cells. We suggest that these CD8+ T cells may function to specifically regulate activated CD4+ T cells during immune responses.

Iron regulatory protein 1 is not required for the modulation of ferritin and transferrin receptor expression by iron in a murine pro-B lymphocyte cell line

Iron regulatory proteins (IRPs) are cytoplasmic RNA binding proteins that are central components of a sensory and regulatory network that modulates vertebrate iron homeostasis. IRPs regulate iron metabolism by binding to iron responsive element(s) (IREs) in the 5′ or 3′ untranslated region of ferritin or transferrin receptor (TfR) mRNAs. Two IRPs, IRP1 and IRP2, have been identified previously. IRP1 exhibits two mutually exclusive functions as an RNA binding protein or as the cytosolic isoform of aconitase. We demonstrate that the Ba/F3 family of murine pro-B lymphocytes represents the first example of a mammalian cell line that fails to express IRP1 protein or mRNA. First, all of the IRE binding activity in Ba/F3-gp55 cells is attributable to IRP2. Second, synthesis of IRP2, but not of IRP1, is detectable in Ba/F3-gp55 cells. Third, the Ba/F3 family of cells express IRP2 mRNA at a level similar to other murine cell lines, but IRP1 mRNA is not detectable. In the Ba/F3 family of cells, alterations in iron status modulated ferritin biosynthesis and TfR mRNA level over as much as a 20- and 14-fold range, respectively. We conclude that IRP1 is not essential for regulation of ferritin or TfR expression by iron and that IRP2 can act as the sole IRE-dependent mediator of cellular iron homeostasis.

An essential regulatory role for macrophage migration inhibitory factor in T-cell activation.

The protein known as macrophage migration inhibitory factor (MIF) was one of the first cytokines to be discovered and was described 30 years ago to be a T-cell-derived factor that inhibited the random migration of macrophages in vitro. A much broader role for MIF has emerged recently as a result of studies that have demonstrated it to be released from the anterior pituitary gland in vivo. MIF also is the first protein that has been identified to be secreted from monocytes/macrophages upon glucocorticoid stimulation. Once released, MIF acts to "override" or counter-regulate the suppressive effects of glucocorticoids on macrophage cytokine production. We report herein that MIF plays an important regulatory role in the activation of T cells induced by mitogenic or antigenic stimuli. Activated T cells produce MIF and neutralizing anti-MIF antibodies inhibit T-cell proliferation and interleukin 2 production in vitro, and suppress antigen-driven T-cell activation and antibody production in vivo. T cells also release MIF in response to glucocorticoid stimulation and MIF acts to override glucocorticoid inhibition of T-cell proliferation and interleukin 2 and interferon gamma production. These studies indicate that MIF acts in concert with glucocorticoids to control T-cell activation and assign a previously unsuspected but critical role for MIF in antigen-specific immune responses.

Crystal structure of the cell cycle-regulatory protein suc1 reveals a beta-hinge conformational switch.

The Schizosaccharomyces pombe cell cycle-regulatory protein suc1, named as the suppressor of cdc2 temperature-sensitive mutations, is essential for cell cycle progression. To understand suc1 structure-function relationships and to help resolve conflicting interpretations of suc1 function based on genetic studies of suc1 and its functional homologs in both lower and higher eukaryotes, we have determined the crystal structure of the beta-interchanged suc1 dimer. Each domain consists of three alpha-helices and a four-stranded beta-sheet, completed by the interchange of terminal beta-strands between the two subunits. This beta-interchanged suc1 dimer, when compared with the beta-hairpin single-domain folds of suc1, reveals a beta-hinge motif formed by the conserved amino acid sequence HVPEPH. This beta-hinge mediates the subunit conformation and assembly of suc1: closing produces the intrasubunit beta-hairpin and single-domain fold, whereas opening leads to the intersubunit beta-strand interchange and interlocked dimer assembly reported here. This conformational switch markedly changes the surface accessibility of sequence-conserved residues available for recognition of cyclin-dependent kinase, suggesting a structural mechanism for beta-hinge-mediated regulation of suc1 biological function. Thus, suc1 belongs to the family of domain-swapping proteins, consisting of intertwined and dimeric protein structures in which the dual assembly modes regulate their function.

Opposing early and late effects of insulin-like growth factor I on differentiation and the cell cycle regulatory retinoblastoma protein in skeletal myoblasts.

The mechanisms by which insulin-like growth factors (IGFs) can be both mitogenic and differentiation-promoting in skeletal myoblasts are unclear because these two processes are believed to be mutually exclusive in this tissue. The phosphorylation state of the ubiquitous nuclear retinoblastoma protein (Rb) plays an important role in determining whether myoblasts proliferate or differentiate: Phosphorylated Rb promotes mitogenesis, whereas un- (or hypo-) phosphorylated Rb promotes cell cycle exit and differentiation. We hypothesized that IGFs might affect the fate of myoblasts by regulating the phosphorylation of Rb. Although long-term IGF treatment is known to stimulate differentiation, we find that IGFs act initially to inhibit differentiation and are exclusively mitogenic. These early effects of IGFs are associated with maintenance of Rb phosphorylation typical of proliferating cells; upregulation of the gene expression of cyclin-dependent kinase 4 and cyclin D1, components of a holoenzyme that plays a principal role in mediating Rb phosphorylation; and marked inhibition of the gene expression of myogenin, a member of the MyoD family of skeletal muscle-specific transcription factors that is essential in muscle differentiation. We also find that IGF-induced inhibition of differentiation occurs through a process that is independent of its mitogenic effects. We demonstrate, thus, that IGFs regulate Rb phosphorylation and cyclin D1 and cyclin-dependent kinase 4 gene expression; together with their biphasic effects on myogenin expression, these results suggest a mechanism by which IGFs are initially mitogenic and subsequently differentiation-promoting in skeletal muscle.

Identification of human granzyme B promoter regulatory elements interacting with activated T-cell-specific proteins: implication of Ikaros and CBF binding sites in promoter activation.

Granzyme B serine protease is found in the granules of activated cytotoxic T cells and in natural and lymphokine-activated killer cells. This protease plays a critical role in the rapid induction of target cell DNA fragmentation. The DNA regulatory elements that are responsible for the specificity of granzyme B gene transcription in activated T-cells reside between nt -148 and +60 (relative to the transcription start point at +1) of the human granzyme B gene promoter. This region contains binding sites for the transcription factors Ikaros, CBF, Ets, and AP-1. Mutational analysis of the human granzyme B promoter reveals that the Ikaros binding site (-143 to -114) and the AP-1/CBF binding site (-103 to -77) are essential for the activation of transcription in phytohemagglutinin-activated peripheral blood lymphocytes, whereas mutation of the Ets binding site does not affect promoter activity in these cells.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Impaired fetal T cell development and perinatal lethality in mice lacking the cAMP response element binding protein

CREB, the cAMP response element binding protein, is a key transcriptional regulator of a large number of genes containing a CRE consensus sequence in their upstream regulatory regions. Mice with a hypomorphic allele of CREB that leads to a loss of the CREBα and Δ isoforms and to an overexpression of the CREBβ isoform are viable. Herein we report the generation of CREB null mice, which have all functional isoforms (CREBα, β, and Δ) inactivated. In contrast to the CREBαΔ mice, CREB null mice are smaller than their littermates and die immediately after birth from respiratory distress. In brain, a strong reduction in the corpus callosum and the anterior commissures is observed. Furthermore, CREB null mice have an impaired fetal T cell development of the αβ lineage, which is not affected in CREBαΔ mice on embryonic day 18.5. Overall thymic cellularity in CREB null mice is severely reduced affecting all developmental stages of the αβ T cell lineage. In contrast γδ T cell differentiation is normal in CREB mutant mice.

Cross-lineage expression of Ig-β (B29) in thymocytes: Positive and negative gene regulation to establish T cell identity

Developmental commitment involves activation of lineage-specific genes, stabilization of a lineage-specific gene expression program, and permanent inhibition of inappropriate characteristics. To determine how these processes are coordinated in early T cell development, the expression of T and B lineage-specific genes was assessed in staged subsets of immature thymocytes. T lineage characteristics are acquired sequentially, with germ-line T cell antigen receptor-β transcripts detected very early, followed by CD3ɛ and terminal deoxynucleotidyl transferase, then pTα, and finally RAG1. Only RAG1 expression coincides with commitment. Thus, much T lineage gene expression precedes commitment and does not depend on it. Early in the course of commitment to the T lineage, thymocytes lose the ability to develop into B cells. To understand how this occurs, we also examined expression of well defined B lineage-specific genes. Although λ5 and Ig-α are not expressed, the μ0 and Iμ transcripts from the unrearranged IgH locus are expressed early, in distinct patterns, then repressed just before RAG1 expression. By contrast, RNA encoding the B cell receptor component Ig-β was found to be transcribed in all immature thymocyte subpopulations and throughout most thymocyte differentiation. Ig-β expression is down-regulated only during positive selection of CD4+CD8– cells. Thus several key participants in the B cell developmental program are expressed in non-B lineage-committed cells, and one is maintained even through commitment to an alternative lineage, and repressed only after extensive T lineage differentiation. The results show that transcriptional activation of “lymphocyte-specific” genes can occur in uncommitted precursors, and that T lineage commitment is a composite of distinct positive and negative regulatory events.

Photodynamic therapy results in induction of WAF1/CIP1/P21 leading to cell cycle arrest and apoptosis

Photodynamic therapy (PDT) is a promising new modality that utilizes a combination of a photosensitizing chemical and visible light for the management of a variety of solid malignancies. The mechanism of PDT-mediated cell killing is not well defined. We investigated the involvement of cell cycle regulatory events during silicon phthalocyanine (Pc4)-PDT-mediated apoptosis in human epidermoid carcinoma cells A431. PDT resulted in apoptosis, inhibition of cell growth, and G0-G1 phase arrest of the cell cycle, in a time-dependent fashion. Western blot analysis revealed that PDT results in an induction of the cyclin kinase inhibitor WAF1/CIP1/p21, and a down-regulation of cyclin D1 and cyclin E, and their catalytic subunits cyclin-dependent kinase (cdk) 2 and cdk6. The treatment also resulted in a decrease in kinase activities associated with all the cdks and cyclins examined. PDT also resulted in (i) an increase in the binding of cyclin D1 and cdk6 toward WAF1/CIP1/p21, and (ii) a decrease in the binding of cyclin D1 toward cdk2 and cdk6. The binding of cyclin E and cdk2 toward WAF1/CIP1/p21, and of cyclin E toward cdk2 did not change by the treatment. These data suggest that PDT-mediated induction of WAF1/CIP1/p21 results in an imposition of artificial checkpoint at G1 → S transition thereby resulting in an arrest of cells in G0-G1 phase of the cell cycle through inhibition in the cdk2, cdk6, cyclin D1, and cyclin E. We suggest that this arrest is an irreversible process and the cells, unable to repair the damages, ultimately undergo apoptosis.

MgATP activates the β cell KATP channel by interaction with its SUR1 subunit

ATP-sensitive potassium (KATP) channels in the pancreatic β cell membrane mediate insulin release in response to elevation of plasma glucose levels. They are open at rest but close in response to glucose metabolism, producing a depolarization that stimulates Ca2+ influx and exocytosis. Metabolic regulation of KATP channel activity currently is believed to be mediated by changes in the intracellular concentrations of ATP and MgADP, which inhibit and activate the channel, respectively. The β cell KATP channel is a complex of four Kir6.2 pore-forming subunits and four SUR1 regulatory subunits: Kir6.2 mediates channel inhibition by ATP, whereas the potentiatory action of MgADP involves the nucleotide-binding domains (NBDs) of SUR1. We show here that MgATP (like MgADP) is able to stimulate KATP channel activity, but that this effect normally is masked by the potent inhibitory effect of the nucleotide. Mg2+ caused an apparent reduction in the inhibitory action of ATP on wild-type KATP channels, and MgATP actually activated KATP channels containing a mutation in the Kir6.2 subunit that impairs nucleotide inhibition (R50G). Both of these effects were abolished when mutations were made in the NBDs of SUR1 that are predicted to abolish MgATP binding and/or hydrolysis (D853N, D1505N, K719A, or K1384M). These results suggest that, like MgADP, MgATP stimulates KATP channel activity by interaction with the NBDs of SUR1. Further support for this idea is that the ATP sensitivity of a truncated form of Kir6.2, which shows functional expression in the absence of SUR1, is unaffected by Mg2+.

Activity and nature of p21WAF1 complexes during the cell cycle

Elevated levels of the p21WAF1 (p21) cyclin-dependent kinase inhibitor induce growth arrest. We have characterized a panel of monoclonal antibodies against human p21 in an effort to understand the dynamic regulatory interactions between this and other cellular proteins during the cell cycle. The use of these reagents has allowed us to address several important, yet unresolved, issues concerning the biological activity of p21, including the potential kinase activity of complexes that associate with this cyclin-dependent kinase inhibitor. We have found that the kinase activity of cyclin A/Cdk2 associated with p21 is significantly lower than that of cyclin A/Cdk2 free of p21, suggesting that p21 abolishes its activity in vivo, and the use of multiple antibodies has enabled us to begin the study of the molecular architecture of p21 complexes in vivo. In addition, we found that human fibroblasts released from a quiescent state display abundant amounts of p21 devoid of associated proteins (“free” p21), the levels of which decrease as cells approach S phase. Cyclin A levels increase as the amount of monomeric p21 decreases, resulting in an excess of cyclin A/Cdk2 complexes that are not bound to, or inactivated by, p21. Our data strengthen the notion that the G1-to-S phase transition in human fibroblasts occurs when the concentration of cyclin A/Cdk2 surpasses that of p21.

Cell-cycle arrest and apoptosis hypersusceptibility as a consequence of Lck deficiency in nontransformed T lymphocytes

By using antisense RNA, Lck-deficient transfectants of a T helper 2 (Th2) clone have been derived and shown to have a qualitative defect in the T cell receptor signaling pathway. A striking feature observed only in Lck-deficient T cells was the presence of a constitutively tyrosine-phosphorylated 32-kDa protein. In the present study, we provide evidence that this aberrantly hyperphosphorylated protein is p34cdc2 (cdc2) a key regulator of cell-cycle progression. Lck-deficient transfectants expressed high levels of cdc2 protein and its regulatory units, cyclins A and B. The majority of cdc2, however, was tyrosine-phosphorylated and therefore enzymatically inactive. The transfectants were significantly larger than the parental cells and contained 4N DNA. These results establish that a deficiency in Lck leads to a cell-cycle arrest in G2. Moreover, transfected cells were hypersusceptible to apoptosis when activated through the T cell receptor. Importantly, however, this hypersusceptibility was largely reversed in the presence of T cell growth factors. These findings provide evidence that, in mature T lymphocytes, cell-cycle progression through the G2–M check point requires expression of the Src-family protein tyrosine kinase, Lck. This requirement is Lck-specific; it is observed under conditions in which the closely related Fyn kinase is expressed normally, evincing against a redundancy of function between these two kinases.

Rapid and efficient fusion of phospholipid vesicles by the α-helical core of a SNARE complex in the absence of an N-terminal regulatory domain

A protease-resistant core domain of the neuronal SNARE complex consists of an α-helical bundle similar to the proposed fusogenic core of viral fusion proteins [Skehel, J. J. & Wiley, D. C. (1998) Cell 95, 871–874]. We find that the isolated core of a SNARE complex efficiently fuses artificial bilayers and does so faster than full length SNAREs. Unexpectedly, a dramatic increase in speed results from removal of the N-terminal domain of the t-SNARE syntaxin, which does not affect the rate of assembly of v-t SNARES. In the absence of this negative regulatory domain, the half-time for fusion of an entire population of lipid vesicles by isolated SNARE cores (≈10 min) is compatible with the kinetics of fusion in many cell types.