Differential sensitivity of stilbenedisulfonates in their reaction with band 3 HT (Pro-868-->Leu).

Band 3 HT (Pro-868-->Leu) is a mutant anion exchange protein which has several phenotypic characteristics, including a 2- to 3-fold larger Vmax, and reduced covalent binding of the anion transport inhibitor 4,4'-diisothiocyanodihydrostilbene-2,2'-disulfonate (H2DIDS). We have used fluorescence kinetic methods to study inhibitor binding to band 3 to determine if the point mutation in band 3 HT produces localized or wide-spread conformational changes within the membrane-bound domain of this transporter. Our results show that covalent binding of H2DIDS by band 3 HT is slower by a factor of 10 to 20 compared with the wild-type protein. In contrast, no such difference in the kinetics was observed for covalent binding of 4,4'-diisothiocyanostilbene-2,2'-disulfonate (DIDS). In addition, the kinetics of H2DIDS release from band 3 HT was abnormal, while the kinetics of 4,4'-dibenzamidostilbene-2,2'-disulfonate (DBDS) release showed no difference when compared with the wild-type protein. We conclude that substitution of leucine for proline at position 868 does not perturb the structure of "lysine A" in the membrane-bound domain of band 3 but rather produces an apparently localized conformational change in the C-terminal subdomain of the protein which alters H2DIDS affinity. When combined with the observation of an increased Vmax, these results suggest that protein structural changes at position 868 influence a turnover step in the transport cycle.

NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids.

Altered regulation of platelet-derived growth factor receptor-α gene-transcription in vitro by spina bifida-associated mutant Pax1 proteins

Mouse models show that congenital neural tube defects (NTDs) can occur as a result of mutations in the platelet-derived growth factor receptor-α gene (PDGFRα). Mice heterozygous for the PDGFRα-mutation Patch, and at the same time homozygous for the undulated mutation in the Pax1 gene, exhibit a high incidence of lumbar spina bifida occulta, suggesting a functional relation between PDGFRα and Pax1. Using the human PDGFRα promoter linked to a luciferase reporter, we show in the present paper that Pax1 acts as a transcriptional activator of the PDGFRα gene in differentiated Tera-2 human embryonal carcinoma cells. Two mutant Pax1 proteins carrying either the undulated-mutation or the Gln → His mutation previously identified by us in the PAX1 gene of a patient with spina bifida, were not or less effective, respectively. Surprisingly, Pax1 mutant proteins appear to have opposing transcriptional activities in undifferentiated Tera-2 cells as well as in the U-2 OS osteosarcoma cell line. In these cells, the mutant Pax1 proteins enhance PDGFRα-promoter activity whereas the wild-type protein does not. The apparent up-regulation of PDGFRα expression in these cells clearly demonstrates a gain-of-function phenomenon associated with mutations in Pax genes. The altered transcriptional activation properties correlate with altered protein–DNA interaction in band-shift assays. Our data provide additional evidence that mutations in Pax1 can act as a risk factor for NTDs and suggest that the PDGFRα gene is a direct target of Pax1. In addition, the results support the hypothesis that deregulated PDGFRα expression may be causally related to NTDs.

Transport of torsional stress in DNA

It is well known that transcription can induce torsional stress in DNA, affecting the activity of nearby genes or even inducing structural transitions in the DNA duplex. It has long been assumed that the generation of significant torsional stress requires the DNA to be anchored, forming a limited topological domain, because otherwise it would spin almost freely about its axis. Previous estimates of the rotational drag have, however, neglected the role of small natural bends in the helix backbone. We show how these bends can increase the drag several thousandfold relative to prior estimates, allowing significant torsional stress even in linear unanchored DNA. The model helps explain several puzzling experimental results on structural transitions induced by transcription of DNA.

Structure of the recombinant full-length hamster prion protein PrP(29–231): The N terminus is highly flexible

The prion diseases seem to be caused by a conformational change of the prion protein (PrP) from the benign cellular form PrPC to the infectious scrapie form PrPSc; thus, detailed information about PrP structure may provide essential insights into the mechanism by which these diseases develop. In this study, the secondary structure of the recombinant Syrian hamster PrP of residues 29–231 [PrP(29–231)] is investigated by multidimensional heteronuclear NMR. Chemical shift index analysis and nuclear Overhauser effect data show that PrP(29–231) contains three helices and possibly one short β-strand. Most striking is the random-coil nature of chemical shifts for residues 30–124 in the full-length PrP. Although the secondary structure elements are similar to those found in mouse PrP fragment PrP(121–231), the secondary structure boundaries of PrP(29–231) are different from those in mouse PrP(121–231) but similar to those found in the structure of Syrian hamster PrP(90–231). Comparison of resonance assignments of PrP(29–231) and PrP(90–231) indicates that there may be transient interactions between the additional residues and the structured core. Backbone dynamics studies done by using the heteronuclear [1H]-15N nuclear Overhauser effect indicate that almost half of PrP(29–231), residues 29–124, is highly flexible. This plastic region could feature in the conversion of PrPC to PrPSc by template-assisted formation of β-structure.

HUNT: launch of a full-length cDNA database from the Helix Research Institute

The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.

A short segment within the cytoplasmic domain of the neural cell adhesion molecule (N-CAM) is essential for N-CAM-induced NF-κB activity in astrocytes

The neural cell adhesion molecule (N-CAM) is expressed on the surface of astrocytes, where its homophilic binding leads to the activation of the transcription factor NF-κB. Transfection of astrocytes with a construct encompassing the transmembrane region and the cytoplasmic domain of N-CAM (designated Tm-Cyto, amino acids 685–839 in the full-length molecule) inhibited this activation up to 40%, and inhibited N-CAM-induced translocation of NF-κB to the nucleus. N-CAM also activated NF-κB in astrocytes from N-CAM knockout mice, presumably through binding to a heterophile. This activation, however, was not blocked by Tm-Cyto expression, indicating that the inhibitory effect of the Tm-Cyto construct is specific for cell surface N-CAM. Deletions and point mutations of the cytoplasmic portion of the Tm-Cyto construct indicated that the region between amino acids 780 and 800 were essential for inhibitory activity. This region contains four threonines (788, 793, 794, and 797). Mutation to alanine of T788, T794, or T797, but not T793, abolished inhibitory activity, as did mutation of T788 or T797 to aspartic acid. A Tm-Cyto construct with T794 mutated to aspartic acid retained inhibitory activity but did not itself induce a constitutive NF-κB response. This result suggests that phosphorylation of T794 may be necessary but is not the triggering event. Overall, these findings define a short segment of the N-CAM cytoplasmic domain that is critical for N-CAM-induced activation of NF-κB and may be important in other N-CAM-mediated signaling.

Induction and repression of DAN1 and the family of anaerobic mannoprotein genes in Saccharomyces cerevisiae occurs through a complex array of regulatory sites

The DAN/TIR mannoprotein genes of Saccharomyces cerevisiae (DAN1, DAN2, DAN3, DAN4, TIR1, TIR2, TIR3 and TIR4) are expressed in anaerobic cells while the predominant cell wall proteins Cwp1 and Cwp2 are down-regulated. Elements involved in activation and repression of the DAN/TIR genes were defined in this study, using the DAN1 promoter as a model. Nested deletions in a DAN1/lacZ reporter pinpointed regions carrying activation and repression elements. Inspection revealed two consensus sequences subsequently shown to be independent anaerobic response elements (AR1, consensus TCGTTYAG; AR2, consensus AAAAATTGTTGA). AR1 is found in all of the DAN/TIR promoters; AR2 is found in DAN1, DAN2 and DAN3. A 120 bp segment carrying two copies of AR1 preferentially activated transcription of lacZ under anaerobic conditions. A fusion of three synthetic copies of AR1 to MEL1 was also expressed anaerobically. Mutations in either AR1 site within the 120 bp segment caused a drastic loss of expression, indicating that both are necessary for activation and implying cooperativity between adjacent transcriptional activation complexes. A single AR2 site carried on a 46 bp fragment from the DAN1 promoter activated lacZ transcription under anaerobic conditions, as did a 26 bp synthetic AR2 fragment fused to MEL1. Nucleotide substitutions within the AR2 sequence eliminated the activity of the 46 bp segment. Ablation of the AR2 sequences in the full promoter caused a partial reduction of expression. The presence of the ATTGTT core (recognized by HMG proteins) in the AR2 sequence suggests that an HMG protein may activate through AR2. One region was implicated in aerobic repression of DAN1. It contains sites for the heme-induced Mot3 and Rox1 repressors.

Evidence for clonal propagation in natural isolates of Plasmodium falciparum from Venezuela

We have analyzed 75 isolates of Plasmodium falciparum, collected in Venezuela during both the dry (November) and rainy (May–July) seasons, with a range of genetic markers including antigen genes and 14 random amplified polymorphic DNA (RAPD) primers. Thirteen P. falciparum stocks from Kenya and four other Plasmodium species are included in the analysis for comparison. Cross-hybridization shows that the 14 RAPD primers reveal 14 separate regions of the parasite's genome. The P. falciparum isolates are a monophyletic clade, significantly different from the other Plasmodium species. We identify three RAPD characters that could be useful as “tags” for rapid species identification. The Venezuelan genotypes fall into two discrete genetic subdivisions associated with either the dry or the rainy season; the isolates collected in the rainy season exhibit greater genetic diversity. There is significant linkage disequilibrium in each seasonal subsample and in the full sample. In contrast, no linkage disequilibrium is detected in the African sample. These results support the hypothesis that the population structure of P. falciparum in Venezuela, but not in Africa, is predominantly clonal. However, the impact of genetic recombination on Venezuelan P. falciparum seems higher than in parasitic species with long-term clonal evolution like Trypanosoma cruzi, the agent of Chagas' disease. The genetic structure of the Venezuelan samples is similar to that of Escherichia coli, a bacterium that propagates clonally, with occasional genetic recombination.

Molecular cytogenetic delineation of a novel critical genomic region in chromosome bands 11q22.3-923.1 in lymphoproliferative disorders.

Aberrations of the long arm of chromosome 11 are among the most common chromosome abnormalities in lymphoproliferative disorders (LPD). Translocations involving BCL1 at 11q13 are strongly associated with mantle cell lymphoma. other nonrandom aberrations, especially deletions and, less frequently, translocations, involving bands 11q21-923 have been identified by chromosome banding analysis. To date, the critical genomic segment and candidate genes involved in these deletions have not been identified. In the present study, we have analyzed tumors from 43 patients with LPD (B-cell chronic lymphocytic leukemia, n = 40; mantle cell lymphoma, n = 3) showing aberrations of bands 11q21-923 by fluorescence in situ hybridization. As probes we used Alu-PCR products from 17 yeast artificial chromosome clones spanning chromosome bands 11q14.3-923.3, including a panel of yeast artificial chromosome clones recognizing a contiguous genomic DNA fragment of approximately 9-10 Mb in bands 11q22.3-923.3. In the 41 tumors exhibiting deletions, we identified a commonly deleted segment in band 11q22.3-923.1; this region is approximately 2-3 Mb in size and contains the genes coding for ATM (ataxia telangiectasia mutated), RDX (radixin), and FDX1 (ferredoxin 1). Furthermore, two translocation break-points were localized to a 1.8-Mb genomic fragment contained within the commonly deleted segment. Thus, we have identified a single critical region of 2-3 Mb in size in which 11q14-923 aberrations in LPD cluster. This provides the basis for the identification of the gene(s) at 11q22.3-923.1 that are involved in the pathogenesis of LPD.

Vitamin E prevents oxidative modification of brain and lymphocyte band 3 proteins during aging.

Antioxidants may play an important role in preventing free radical damage associated with aging by interfering directly in the generation of radicals or by scavenging them. We investigated the effects of a high vitamin E and/or a high beta-carotene diet on aging of the anion transporter, band 3, in lymphocytes and brain. The band 3 proteins function as anion transporters, acid base regulators, C02 transporters, and structural proteins that provide a framework for membrane lipids and that link the plasma membrane to the cytoskeleton. Senescent cell antigen (SCA), which terminates the life of cells, is a degradation product of band 3. This study was conducted as a double-blind study in which eight groups of middle-aged or old mice received either high levels of beta-carotene and/or vitamin E or standard levels of these supplements in their diets. Anion transport kinetic assays were performed on isolated splenic lymphocytes. Immunoreactivity of an antibody that recognizes aging changes in old band 3 preceding generation of SCA was used to quantitate aged band 3 in brain tissue. Results indicate that vitamin E prevented the observed age-related decline in anion transport by lymphocytes and the generation of aged band 3 leading to SCA formation. beta-Carotene had no significant effect on the results of either assay. Since increased aged band 3 and decreased anion transport are initial steps in band 3 aging, which culminates in the generation of SCA and cellular removal, vitamin E prevents or delays aging of band 3-related proteins in lymphocytes and brain.

Stable loop in the crystal structure of the intercalated four-stranded cytosine-rich metazoan telomere.

In most metazoans, the telomeric cytosine-rich strand repeating sequence is d(TAACCC). The crystal structure of this sequence was solved to 1.9-A resolution. Four strands associate via the cytosine-containing parts to form a four-stranded intercalated structure held together by C.C+ hydrogen bonds. The base-paired strands are parallel to each other, and the two duplexes are intercalated into each other in opposite orientations. One TAA end forms a highly stabilized loop with the 5' thymine Hoogsteen-base-paired to the third adenine. The 5' end of this loop is in close proximity to the 3' end of one of the other intercalated cytosine strands. Instead of being entirely in a DNA duplex, this structure suggests the possibility of an alternative conformation for the cytosine-rich telomere strands.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

The β subunit sliding DNA clamp is responsible for unassisted mutagenic translesion replication by DNA polymerase III holoenzyme

The replication of damaged nucleotides that have escaped DNA repair leads to the formation of mutations caused by misincorporation opposite the lesion. In Escherichia coli, this process is under tight regulation of the SOS stress response and is carried out by DNA polymerase III in a process that involves also the RecA, UmuD′ and UmuC proteins. We have shown that DNA polymerase III holoenzyme is able to replicate, unassisted, through a synthetic abasic site in a gapped duplex plasmid. Here, we show that DNA polymerase III*, a subassembly of DNA polymerase III holoenzyme lacking the β subunit, is blocked very effectively by the synthetic abasic site in the same DNA substrate. Addition of the β subunit caused a dramatic increase of at least 28-fold in the ability of the polymerase to perform translesion replication, reaching 52% bypass in 5 min. When the ssDNA region in the gapped plasmid was extended from 22 nucleotides to 350 nucleotides, translesion replication still depended on the β subunit, but it was reduced by 80%. DNA sequence analysis of translesion replication products revealed mostly −1 frameshifts. This mutation type is changed to base substitution by the addition of UmuD′, UmuC, and RecA, as demonstrated in a reconstituted SOS translesion replication reaction. These results indicate that the β subunit sliding DNA clamp is the major determinant in the ability of DNA polymerase III holoenzyme to perform unassisted translesion replication and that this unassisted bypass produces primarily frameshifts.

Cloning and characterization of TDD5, an androgen target gene that is differentially repressed by testosterone and dihydrotestosterone

By using mRNA polymerase chain reaction differential display technique (DDPCR), we have identified one early responsive cDNA fragment, TDD5, from a 5α-reductase-deficient T cell hybridoma. The DDPCR profiles of TDD5 suggest that its expression can be repressed by testosterone (T) within 2 hr. More importantly, both DDPCR and Northern blot analysis further demonstrated that the expression of TDD5 was differentially repressed by T and dihydrotestosterone (DHT) at the mRNA level. To our knowledge, this is the first androgen target gene to show a preference in response to T over DHT in cell culture. TDD5 is expressed in several tissues with particular abundance in kidney. Full-length TDD5 cDNA (2,916 bp) encodes a protein with a calculated molecular weight of 42,000. Finally, our animal studies further confirm that TDD5 mRNA levels can be repressed to the basal level 8 hr after DHT administration. The isolation and characterization of the early-responsive androgen target gene TDD5 and the fact that TDD5 mRNA level can be differentially regulated by T and DHT may provide a useful tool to study the molecular mechanism of androgen preference on target gene regulation.