12 resultados para INTERLEUKINS

em National Center for Biotechnology Information - NCBI


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Gene targeting was used to create mice with a null mutation of the gene encoding the common beta subunit (beta C) of the granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin 3 (IL-3; multi-CSF), and interleukin 5 (IL-5) receptor complexes (beta C-/- mice). High-affinity binding of GM-CSF was abolished in beta C-/- bone marrow cells, while cells from heterozygous animals (beta C+/- mice) showed an intermediate number of high-affinity receptors. Binding of IL-3 was unaffected, confirming that the IL-3-specific beta chain remained intact. Eosinophil numbers in peripheral blood and bone marrow of beta C-/- animals were reduced, while other hematological parameters were normal. In clonal cultures of beta C-/- bone marrow cells, even high concentrations of GM-CSF and IL-5 failed to stimulate colony formation, but the cells exhibited normal quantitative responsiveness to stimulation by IL-3 and other growth factors. beta C-/- mice exhibited normal development and survived to young adult life, although they developed pulmonary peribronchovascular lymphoid infiltrates and areas resembling alveolar proteinosis. There was no detectable difference in the systemic clearance and distribution of GM-CSF between beta C-/- and wild-type littermates. The data establish that beta C is normally limiting for high-affinity binding of GM-CSF and demonstrate that systemic clearance of GM-CSF is not mediated via such high-affinity receptor complexes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The cytokines interleukin 2 (IL-2) and IL-15 have similar biological effects on T cells and bind common hematopoietin receptor subunits. Pathways that involve Janus kinases (JAKs) and signal transducers and activators of transcription (STATs) have been shown to be important for hematopoietin receptor signaling. In this study we identify the STAT proteins activated by IL-2 and IL-15 in human T cells. IL-2 and IL-15 rapidly induced the tyrosine phosphorylation of STAT3 and STAT5, and DNA-binding complexes containing STAT3 and STAT5 were rapidly activated by these cytokines in T cells. IL-4 induced tyrosine phosphorylation and activation of STAT3 but not STAT5. JAK1 and JAK3 were tyrosine-phosphorylated in response to IL-2 and IL-15. Hence, the JAK and STAT molecules that are activated in response to IL-2 and IL-15 are similar but differ from those induced by IL-4. These observations identify the STAT proteins activated by IL-2 and IL-15 and therefore define signaling pathways by which these T-cell growth factors may regulate gene transcription.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cytokines are important regulators of hematopoesis. Mutations in gamma c, which is a subunit shared by the receptors for interleukin (IL) 2, IL-4, and IL-7, have been causally associated with human X chromosome-linked severe combined immunodeficiency disease. This finding indicates a mandatory role for cytokine receptor signaling at one or more stages of lymphocyte development. To evaluate the cellular level at which gamma c is critical for lymphopoiesis, the effect of monoclonal antibodies to gamma c on the capacity of syngeneic bone marrow cells to reconstitute the hematopoietic compartment of lethally irradiated recipient mice was examined. We show that monoclonal antibody to gamma c blocked lymphocyte development at or before the appearance of pro-B cells and prior to or at the seeding of the thymus by precursor cells while erythromyeloid cell development was normal. These results suggest that one level of lymphocyte development that requires gamma c is a point in hematopoietic cell differentiation near the divergence of lymphopoiesis and erythromyelopoesis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pluripotent hematopoietic stem cells (PHSCs) were highly enriched from mouse bone marrow by counterflow centrifugal elutriation, lineage subtraction, and fluorescence-activated cell sorting based on high c-kit receptor expression (c-kitBR). We used reverse transcriptase polymerase chain reaction to assay the c-kitBR subset and the subsets expressing low (c-kitDULL) and no (c-kitNEG) c-kit receptor for expression of mRNA encoding hematopoietic growth factor receptors and transcription factors. The c-kitBR cells had approximately 3.5-fold more c-kit mRNA than unfractionated bone marrow cells. The c-kitDULL cells had 47-58% of the c-kit mRNA found in c-kitBR cells and the c-kitNEG cells had 4-9% of the c-kit mRNA present in c-kitBR cells. By comparing mRNA levels in c-kitBR cells (enriched for PHSCs) with those of unfractionated bone marrow, we demonstrated that c-kitBR cells contained low or undetectable levels of mRNA for c-fms, granulocyte colony-stimulating factor receptor, interleukin 5 receptor (IL-5R), and IL-7R. These same cells had moderate levels of mRNA for erythropoietin receptor, IL-3R subunits IL-3R alpha (SUT-1), AIC-2A, and AIC-2B, IL-6R and its partner gp-130, and the transcription factor GATA-1 and high levels of mRNA for transcription factors GATA-2, p45 NF-E2, and c-myb. We conclude from these findings that PHSCs are programmed to interact with stem cell factor, IL-3, and IL-6 but not with granulocyte or macrophage colony-stimulating factor. These findings also indicate that GATA-2, p45 NF-E2, and c-myb activities may be involved in PHSC maintenance or proliferation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Assembly and mutual proximities of α, β, and γc subunits of the interleukin 2 receptors (IL-2R) in plasma membranes of Kit 225 K6 T lymphoma cells were investigated by fluorescence resonance energy transfer (FRET) using fluorescein isothiocyanate- and Cy3-conjugated monoclonal antibodies (mAbs) that were directed against the IL-2Rα, IL-2Rβ, and γc subunits of IL-2R. The cell-surface distribution of subunits was analyzed at the nanometer scale (2–10 nm) by FRET on a cell-by-cell basis. The cells were probed in resting phase and after coculture with saturating concentrations of IL-2, IL-7, and IL-15. FRET data from donor- and acceptor-labeled IL-2Rβ-α, γ-α, and γ-β pairs demonstrated close proximity of all subunits to each other in the plasma membrane of resting T cells. These mutual proximities do not appear to represent mAb-induced microaggregation, because FRET measurements with Fab fragments of the mAbs gave similar results. The relative proximities were meaningfully modulated by binding of IL-2, IL-7, and IL-15. Based on FRET analysis the topology of the three subunits at the surface of resting cells can be best described by a “triangular model” in the absence of added interleukins. IL-2 strengthens the bridges between the subunits, making the triangle more compact. IL-7 and IL-15 act in the opposite direction by opening the triangle possibly because they associate their private specific α receptors with the β and/or γc subunits of the IL-2R complex. These data suggest that IL-2R subunits are already colocalized in resting T cells and do not require cytokine-induced redistribution. This colocalization is significantly modulated by binding of relevant interleukins in a cytokine-specific manner.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Interleukin 16 (IL-16) has been shown to function as chemoattractant factor, as a modulator of T-cell activation, and as an inhibitor of immunodeficiency virus replication. The recent identification of inconsistencies in published IL-16 cDNA nucleotide sequences led to the proposal that IL-16 is synthesized in the form of a large precursor protein (pro-IL-16). To identify the true transcriptional start of the IL-16 mRNA rapid amplification of cDNA ends methods were applied. The complete pro-IL-16 cDNA was subsequently molecularly cloned, sequenced, and expressed in COS-7 cells. We report here that pro-IL-16 is most likely synthesized as a 67-kDa protein and is encoded from a major 2.6-kb transcript. Recombinant pro-IL-16 polypeptides are specifically cleaved in lysates of CD8(+) cells, suggesting that the naturally secreted bioactive form of IL-16 is smaller than the originally published 130 amino acids fragment. Moreover, in contrast to other interleukins such as IL-15, IL-16 mRNA expression is almost exclusively limited to lymphatic tissues underlining the potential of IL-16 as an immune regulatory molecule.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Hematopoiesis gives rise to blood cells of different lineages throughout normal life. Abnormalities in this developmental program lead to blood cell diseases including leukemia. The establishment of a cell culture system for the clonal development of hematopoietic cells made it possible to discover proteins that regulate cell viability, multiplication and differentiation of different hematopoietic cell lineages, and the molecular basis of normal and abnormal blood cell development. These regulators include cytokines now called colony-stimulating factors (CSFs) and interleukins (ILs). There is a network of cytokine interactions, which has positive regulators such as CSFs and ILs and negative regulators such as transforming growth factor beta and tumor necrosis factor (TNF). This multigene cytokine network provides flexibility depending on which part of the network is activated and allows amplification of response to a particular stimulus. Malignancy can be suppressed in certain types of leukemic cells by inducing differentiation with cytokines that regulate normal hematopoiesis or with other compounds that use alternative differentiation pathways. This created the basis for the clinical use of differentiation therapy. The suppression of malignancy by inducing differentiation can bypass genetic abnormalities that give rise to malignancy. Different CSFs and ILs suppress programmed cell death (apoptosis) and induce cell multiplication and differentiation, and these processes of development are separately regulated. The same cytokines suppress apoptosis in normal and leukemic cells, including apoptosis induced by irradiation and cytotoxic cancer chemotherapeutic compounds. An excess of cytokines can increase leukemic cell resistance to cytotoxic therapy. The tumor suppressor gene wild-type p53 induces apoptosis that can also be suppressed by cytokines. The oncogene mutant p53 suppresses apoptosis. Hematopoietic cytokines such as granulocyte CSF are now used clinically to correct defects in hematopoiesis, including repair of chemotherapy-associated suppression of normal hematopoiesis in cancer patients, stimulation of normal granulocyte development in patients with infantile congenital agranulocytosis, and increase of hematopoietic precursors for blood cell transplantation. Treatments that decrease the level of apoptosis-suppressing cytokines and downregulate expression of mutant p53 and other apoptosis suppressing genes in cancer cells could improve cytotoxic cancer therapy. The basic studies on hematopoiesis and leukemia have thus provided new approaches to therapy.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Human granulocyte-macrophage colony-stimulating factor (GM-CSF) binds to a high-affinity heterodimeric receptor composed of a specific alpha chain and a common beta chain (beta(c)), which is shared with the receptors for interleukins 3 and 5. Hemopoietic cell survival requires GM-CSF binding this high-affinity receptor. We have recently developed the GM-CSF mutant E21R, which selectively binds to the alpha chain and behaves as a competitive GM-CSF antagonist. We have now examined the role of E21R on the survival of hemopoietic cells and found that E21R causes apoptosis (programmed cell death) of normal and malignant cells directly in the absence of GM-CSF. The direct apoptotic effect of E21R occurred in a dose- and time-dependent manner. Apoptosis by E21R was dependent on cells expressing the high-affinity GM-CSF receptor and could be blocked by GM-CSF. Significantly, apoptosis of the cells occurred even in the presence of the survival factors granulocyte CSF and stem cell factor but was prevented by engagement of beta(c) with interleukin 3. The initiation of apoptosis required phosphorylation, transcriptional activity, and protein synthesis. These findings support a model whereby binding of E21R to the alpha chain leads to apoptosis, while beta(c) plays an important role in cell survival. This model may be applicable to other multimeric cytokine receptors and offers a novel approach for the treatment of human leukemia.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Interleukins 4 (IL-4) and 13 (IL-13) have been found previously to share receptor components on some cells, as revealed by receptor cross-competition studies. In the present study, the cloning is described of murine NR4, a previously unrecognized receptor identified on the basis of sequence similarity with members of the hemopoietin receptor family. mRNA encoding NR4 was found in a wide range of murine cells and tissues. By using transient expression in COS-7 cells, NR4 was found to encode the IL-13 receptor alpha chain, a low-affinity receptor capable of binding IL-13 but not IL-4 or interleukins 2, -7, -9, or -15. Stable expression of the IL-13 receptor alpha chain (NR4) in CTLL-2 cells resulted in the generation of high-affinity IL-13 receptors capable of transducing a proliferative signal in response to IL-13 and, moreover, led to competitive cross-reactivity in the binding of IL-4 and IL-13. These results suggest that the IL-13 receptor alpha chain (NR4) is the primary binding subunit of the IL-13 receptor and may also be a component of IL-4 receptors.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Human T-cell-mediated autoimmune diseases are genetically linked to particular alleles of MHC class II genes. Susceptibility to pemphigus vulgaris (PV), an autoimmune disease of the skin, is linked to a rare subtype of HLA-DR4 (DRB1*0402, 1 of 22 known DR4 subtypes). The PV-linked DR4 subtype differs from a rheumatoid arthritis-associated DR4 subtype (DRB1*0404) only at three residues (DR beta 67, 70, and 71). The disease is caused by autoantibodies against desmoglein 3 (DG), and T cells are thought to trigger the autoantibody production against this keratinocyte adhesion molecule. Based on the DRB1*0402 binding motif, seven candidate peptides of the DG autoantigen were identified. T cells from four PV patients with active disease responded to one of these DG peptides (residues 190-204); two patients also responded to DG-(206-220). T-cell clones specific for DG-(190-204) secreted high levels of interleukins 4 and 10, indicating that they may be important in triggering the production of DG-specific autoantibodies. The DG-(190-204) peptide was presented by the disease-linked DRB1*0402 molecule but not by other DR4 subtypes. Site-directed mutagenesis of DRB1*0402 demonstrated that selective presentation of DG-(190-204), which carries a positive charge at the P4 position, was due to the negatively charged residues of the P4 pocket (DR beta 70 and 71). DR beta 71 has a negative charge in DRB1*0402 but a positive charge in other DR4 subtypes, including the DR4 subtypes linked to rheumatoid arthritis. The charge of the P4 pocket in the DR4 peptide binding site therefore appears to be a critical determinant of MHC-linked susceptibility to PV and rheumatoid arthritis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Neurodegenerative processes in Alzheimer disease (AD) are thought to be driven in part by the deposition of amyloid beta (A beta), a 39- to 43-amino acid peptide product resulting from an alternative cleavage of amyloid precursor protein. Recent descriptions of in vitro neurotoxic effects of A beta support this hypothesis and suggest toxicity might be mediated by A beta-induced neuronal calcium disregulation. In addition, it has been reported that "aging" A beta results in increased toxic potency due to peptide aggregation and formation of a beta-sheet secondary structure. In addition, A beta might also promote neuropathology indirectly by activating immune/inflammatory pathways in affected areas of the brain (e.g., cortex and hippocampus). Here we report that A beta can modulate cytokine secretion [interleukins 6 and 8 (IL-6 and IL-8)] from human astrocytoma cells (U-373 MG). Freshly prepared and aged A beta modestly stimulated IL-6 and IL-8 secretion from U-373 MG cells. However, in the presence of interleukin-1 beta (IL-1 beta), aged, but not fresh, A beta markedly potentiated (3- to 8-fold) cytokine release. In contrast, aged A beta did not potentiate substance P (NK-1)- or histamine (H1)-stimulated cytokine production. Further studies showed that IL-1 beta-induced cytokine release was potentiated by A beta-(25-35), while A beta-(1-16) was inactive. Calcium disregulation may be responsible for the effects of A beta on cytokine production, since the calcium ionophore A23187 similarly potentiated IL-1 beta-induced cytokine secretion and EGTA treatment blocked either A beta or A23187 activity. Thus, chronic neurodegeneration in AD-affected brain regions may be mediated in part by the ability of A beta to exacerbate inflammatory pathways in a conformation-dependent manner.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.