sqv-3, -7, and -8, a set of genes affecting morphogenesis in Caenorhabditis elegans, encode enzymes required for glycosaminoglycan biosynthesis

sqv (squashed vulva) genes comprise a set of eight independent loci in Caenorhabditis elegans required zygotically for the invagination of vulval epithelial cells and maternally for normal oocyte formation and embryogenesis. Sequencing of sqv-3, sqv-7, and sqv-8 suggested a role for the encoded proteins in glycolipid or glycoprotein biosynthesis. Using a combination of in vitro analysis of SQV enzymatic activities, sqv+-mediated rescue of vertebrate cell lines, and biochemical characterization of sqv mutants, we show that sqv-3, -7, and -8 all affect the biosynthesis of glycosaminoglycans and therefore compromise the function of one specific class of glycoconjugates, proteoglycans. These findings establish the importance of proteoglycans and their associated glycosaminoglycans in epithelial morphogenesis and patterning during C. elegans development.

Linking osteopetrosis and pycnodysostosis: Regulation of cathepsin K expression by the microphthalmia transcription factor family

Various genetic conditions produce dysfunctional osteoclasts resulting in osteopetrosis or osteosclerosis. These include human pycnodysostosis, an autosomal recessive syndrome caused by cathepsin K mutation, cathepsin K-deficient mice, and mitf mutant rodent strains. Cathepsin K is a highly expressed cysteine protease in osteoclasts that plays an essential role in the degradation of protein components of bone matrix. Cathepsin K also is expressed in a significant fraction of human breast cancers where it could contribute to tumor invasiveness. Mitf is a member of a helix–loop–helix transcription factor subfamily, which contains the potential dimerization partners TFE3, TFEB, and TFEC. In mice, dominant negative, but not recessive, mutations of mitf, produce osteopetrosis, suggesting a functional requirement for other family members. Mitf also has been found—and TFE3 has been suggested—to modulate age-dependent changes in osteoclast function. This study identifies cathepsin K as a transcriptional target of Mitf and TFE3 via three consensus elements in the cathepsin K promoter. Additionally, cathepsin K mRNA and protein were found to be deficient in mitf mutant osteoclasts, and overexpression of wild-type Mitf dramatically up-regulated expression of endogenous cathepsin K in cultured human osteoclasts. Cathepsin K promoter activity was disrupted by dominant negative, but not recessive, mouse alleles of mitf in a pattern that closely matches their osteopetrotic phenotypes. This relationship between cathepsin K and the Mitf family helps explain the phenotypic overlap of their corresponding deficiencies in pycnodysostosis and osteopetrosis and identifies likely regulators of cathepsin K expression in bone homeostasis and human malignancy.

Mutations in the small subunit of the Drosophila U2AF splicing factor cause lethality and developmental defects.

The essential eukaryotic pre-mRNA splicing factor U2AF (U2 small nuclear ribonucleoprotein auxiliary factor) is required to specify the 3' splice at an early step in spliceosome assembly. U2AF binds site-specifically to the intron polypyrimidine tract and recruits U2 small nuclear ribonucleoprotein to the branch site. Human U2AF (hU2AF) is a heterodimer composed of a large (hU2AF65) and small (hU2AF35) subunit. Although these proteins associate in a tight complex, the biochemical requirement for U2AF activity can be satisfied solely by the large subunit. The requirement for the small subunit in splicing has remained enigmatic. No biochemical activity has been found for hU2AF35 and it has been implicated in splicing only indirectly by its interaction with known splicing factors. In the absence of a biochemical assay, we have taken a genetic approach to investigate the function of the small subunit in the fruit fly Drosophila melanogaster. A cDNA clone encoding the small subunit of Drosophila U2AF (dU2AF38) has been isolated and sequenced. The dU2AF38 protein is highly homologous to hU2AF35 containing a conserved central arginine- and serine-rich (RS) domain. A recessive P-element insertion mutation affecting dU2AF38 causes a reduction in viability and fertility and morphological bristle defects. Consistent with a general role in splicing, a null allele of dU2AF38 is fully penetrant recessive lethal, like null alleles of the Drosophila U2AF large subunit.

Survival of mouse pancreatic islet allografts in recipients treated with allogeneic small lymphocytes and antibody to CD40 ligand.

Combined treatment with allogeneic small lymphocytes or T-depleted small lymphocytes plus a blocking antibody to CD40 ligand (CD40L) permitted indefinite pancreatic islet allograft survival in 37 of 40 recipients that differed from islet donors at major and minor histocompatibility loci. The effect of the allogeneic small lymphocytes was donor antigen-specific. Neither treatment alone was as effective as combined treatment, although anti-CD40L by itself allowed indefinite islet allograft survival in 40% of recipients. Our interpretation is that small lymphocytes expressing donor antigens in the absence of appropriate costimulatory signals are tolerogenic for alloreactive host cells. Anti-CD40L antibody may prevent host T cells from inducing costimulatory signals in donor lymphocytes or islet grafts.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Z-membranes: artificial organelles for overexpressing recombinant integral membrane proteins.

We have expressed a fusion protein formed between the avian infectious bronchitis virus M protein and the bacterial enzyme beta-glucuronidase in transgenic tobacco cells. Electron microscope images of such cells demonstrate that overexpression of this fusion protein gives rise to a type of endoplasmic reticulum membrane domain in which adjacent membranes become zippered together apparently as a consequence of the oligomerizing action of beta-glucuronidase. These zippered (Z-) membranes lack markers of the endoplasmic reticulum (NADH cytochrome c reductase and ribosomes) and accumulate in the cells in the form of multilayered scroll-like structures (up to 2 micrometers in diameter; 20-50 per cell) without affecting plant growth. The discovery of Z-membranes has broad implications for biology and biotechnology in that they provide a means for accumulating large quantities of recombinant membrane proteins within discrete domains of native membranes.

Phosphinate analogs of D-, D-dipeptides: slow-binding inhibition and proteolysis protection of VanX, a D-, D-dipeptidase required for vancomycin resistance in Enterococcus faecium.

VanX is a D-Ala-D-Ala dipeptidase that is essential for vancomycin resistance in Enterococcus faecium. Contrary to most proteases and peptidases, it prefers to hydrolyze the amino substrate but not the related kinetically and thermodynamically more favorable ester substrate D-Ala-D-lactate. The enzymatic activity of VanX was previously found to be inhibited by the phosphinate analogs of the proposed tetrahedral intermediate for hydrolysis of D-Ala-D-Ala. Here we report that such phosphinates are slow-binding inhibitors. D-3-[(1-Aminoethyl)phosphinyl]-D-2-methylpropionic acid I showed a time-dependent onset of inhibition of VanX and a time-dependent return to uninhibited steady-state rates upon dilution of the enzyme/inhibitor mixture. The initial inhibition constant Ki after immediate addition of VanX to phosphinate I to form the E-I complex is 1.5 microM but is then lowered by a relatively slow isomerization step to a second complex, E-I*, with a final K*i of 0.47 microM. This slow-binding inhibition reflects a Km/K*i ratio of 2900:1. The rate constant for the slow dissociation of complex E-I* is 0.24 min-1. A phosphinate analog with an ethyl group replacing what would be the side chain of the second D-alanyl residue in the normal tetrahedral adduct gives a K*i value of 90 nM. Partial proteolysis of VanX reveals two protease-sensitive loop regions that are protected by the intermediate analog phosphinate, indicating that they may be part of the VanX active site.

Elevated expression of H type GDP-L-fucose:beta-D-galactoside alpha-2-L-fucosyltransferase is associated with human colon adenocarcinoma progression.

GDP-L-fucose:beta-D-galactoside alpha-2-L-fucosyltransferase (EC 2.4.1.69) is a key enzyme in the biosynthesis of fucosylated type 1 and 2 lactoseries structures, such as Lewis b and the H type 2 and Lewis Y, respectively, that are accumulated in colon adenocarcinoma. Analysis of the mRNA transcript level for the human H gene-encoded beta-D-galactoside alpha-2-L-fucosyltransferase revealed 40- and 340-fold increases in the mRNA levels in all adenocarcinomas and tumor cell lines, respectively, compared to normal colon mucosa where a low level of mRNA transcript was detected. A variable increase in mRNA transcript levels was observed in 50% of adenomatous polyps. Nucleotide sequence analysis of the protein coding region of the cDNAs derived from normal colon, adenoma, and colon adenocarcinoma revealed 100% homology, suggesting that there are no tumor-associated allelic variations within the H beta-D-galactoside alpha-2-L-fucosyltransferase cDNA. These results suggest that beta-D-galactoside alpha-2-L-fucosyltransferase expression highly correlates with malignant progression of colon adenocarcinoma.