Host–parasite relatedness shown by protein fingerprinting in a brood parasitic bird

Brood parasitism as an alternative female breeding tactic is particularly common in ducks, where hosts often receive eggs laid by parasitic females of the same species and raise their offspring. Herein, we test several aspects of a kin selection explanation for this phenomenon in goldeneye ducks (Bucephala clangula) by using techniques of egg albumen sampling and statistical bandsharing analysis based on resampling. We find that host and primary parasite are indeed often related, with mean r = 0.13, about as high as between first cousins. Relatedness to the host is higher in nests where a parasite lays several eggs than in those where she lays only one. Returning young females parasitize their birth nestmates (social mothers or sisters, which are usually also their genetic mothers and sisters) more often than expected by chance. Such adult relatives are also observed together in the field more often than expected and for longer periods than other females. Relatedness and kin discrimination, which can be achieved by recognition of birth nestmates, therefore play a role in these tactics and probably influence their success.

Evolution of the bilaterian body plan: What have we learned from annelids?

Annelids, unlike their vertebrate or fruit fly cousins, are a bilaterian taxon often overlooked when addressing the question of body plan evolution. However, recent data suggest that annelids offer unique insights on the early evolution of spiral cleavage, anteroposterior axis formation, body axis segmentation, and head versus trunk distinction.

Differential display of intestinal mRNAs regulated by dietary zinc.

Regulation of gene expression by zinc is well established, especially through the metal response elements of the metallothionein genes; however, most other aspects of the functions of zinc in gene expression remain unknown. We have looked for intestinal mRNAs that are regulated by dietary zinc status. Using the reverse transcriptase-PCR method of mRNA differential display, we compared intestinal mRNA from rats that were maintained for 18 days in one of three dietary groups: zinc-deficient, zinc-adequate, and pair-fed zinc-adequate. At the end of this period, total RNA was prepared from the intestine and analyzed by mRNA differential display. Under these conditions, only differentially displayed cDNA bands that varied in the zinc-deficient group, relative to the zinc-adequate groups, were selected. Utilizing two anchored oligo-dT3' PCR primers and a total of 27 arbitrary decamers as 5' PCR primers, our results yielded 47 differentially displayed cDNA bands from intestinal RNA. Thirty were increased in zinc deficiency, and 17 were decreased. Nineteen bands were subcloned and sequenced. Eleven of these were detectable on Northern blots, of which four were confirmed as regulated. Three of these have homology to known genes: cholecystokinin, uroguanylin, and ubiquinone oxidoreductase. The fourth is a novel sequence as it has no significant homology in GenBank. The remainder of those cloned included novel sequences, as well as matches to reported expressed sequence tags, and functionally identified genes. Further characterization of the regulated sequences identified here will show whether they are primary or secondary effects of zinc deficiency.

The genetic link between the Chinese bamboo partridge (Bambusicola thoracica) and the chicken and junglefowls of the genus Gallus.

Further comparison of mitochondrial control-region DNA base sequences of 16 avian species belonging to the subfamily Phasianinae revealed the following: (i) Generalized perdicine birds (quails and partridges) are of ancient lineages. Even the closest pair, the common quail (Coturnix coturnix japonica) and the Chinese bamboo partridge (Bambusicola thoracica), maintained only 85.71% identity. (ii) The 12 species of phasianine birds previously and presently studied belonged to three distinct branches. The first branch was made exclusively of members of the genus Gallus, while the second branch was made of pheasants of the genera Phasianus, Chrysolophus, and Syrmaticus. Gallopheasants of the genus Lophura were distant cousins to these pheasants. The great argus (Argusianus argus) and peafowls of the genus Pavo constituted the third branch. The position of peacock-pheasants of the genus Polyplectron in the third branch was similar to that of the genus Lophura in the second branch. Members of the fourth phasianine branch, such as tragopans and monals, were not included in the present study. (iii) The one perdicine species, Bambusicola thoracica, was more closely related to phasianine genera Gallus and Pavo than to members of other perdicine genera. The above might indicate that Bambusicola belong to one-stem perdicine lineage that later splits into two sublineages that yielded phasianine birds, one evolving to Gallus, and the other differentiating toward Pavo and its allies.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.