2 resultados para Absetz, Brad: In other words

em National Center for Biotechnology Information - NCBI


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Recordings were obtained from the visual system of rats as they cycled normally between waking (W), slow-wave sleep (SWS), and rapid eye movement (REM) sleep. Responses to flashes delivered by a light-emitting diode attached permanently to the skull were recorded through electrodes implanted on the cornea, in the chiasm, and on the cortex. The chiasm response reveals the temporal order in which the activated ganglion cell population exits the eyeball; as reported, this triphasic event is invariably short in latency (5–10 ms) and around 300 ms in duration, called the histogram. Here we describe the differences in the histograms recorded during W, SWS, and REM. SWS histograms are always larger than W histograms, and an REM histogram can resemble either. In other words, the optic nerve response to a given stimulus is labile; its configuration depends on whether the rat is asleep or awake. We link this physiological information with the anatomical fact that the brain dorsal raphe region, which is known to have a sleep regulatory role, sends fibers to the rat retina and receives fibers from it. At the cortical electrode, the visual cortical response amplitudes also vary, being largest during SWS. This well known phenomenon often is explained by changes taking place at the thalamic level. However, in the rat, the labile cortical response covaries with the labile optic nerve response, which suggests the cortical response enhancement during SWS is determined more by what happens in the retina than by what happens in the thalamus.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.