6 resultados para 440206 Studies in Other Religious Traditions

em National Center for Biotechnology Information - NCBI


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The PRNP polymorphic (methionine/valine) codon 129 genotype influences the phenotypic features of transmissible spongiform encephalopathy. All tested cases of new variant Creutzfeldt–Jakob disease (nvCJD) have been homozygous for methionine, and it is conjectural whether different genotypes, if they appear, might have distinctive phenotypes and implications for the future “epidemic curve” of nvCJD. Genotype-phenotype studies of kuru, the only other orally transmitted transmissible spongiform encephalopathy, might be instructive in predicting the answers to these questions. We therefore extracted DNA from blood clots or sera from 92 kuru patients, and analyzed their codon 129 PRNP genotypes with respect to the age at onset and duration of illness and, in nine cases, to detailed clinical and neuropathology data. Homozygosity at codon 129 (particularly for methionine) was associated with an earlier age at onset and a shorter duration of illness than was heterozygosity, but other clinical characteristics were similar for all genotypes. In the nine neuropathologically examined cases, the presence of histologically recognizable plaques was limited to cases carrying at least one methionine allele (three homozygotes and one heterozygote). If nvCJD behaves like kuru, future cases (with longer incubation periods) may begin to occur in older individuals with heterozygous codon 129 genotypes and signal a maturing evolution of the nvCJD “epidemic.” The clinical phenotype of such cases should be similar to that of homozygous cases, but may have less (or at least less readily identified) amyloid plaque formation.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We have developed methods to use anticyclin A, B, and E antibodies as reagents to specifically detect proliferating cells in specific phases of the cell cycle in formalin-fixed, paraffin-embedded sections of tissues and cells. Staining of 48 archival cases of breast cancer showed that these antibodies estimate the tumor proliferation fraction and therefore are potentially useful for the prediction of prognosis. A subset of cancers had a high frequency of tumor cells expressing cyclins A and E, out of proportion to other proliferation markers, suggesting that these tumors may have deregulated cyclin expression. In addition to recognizing authentic cyclin E in the nucleus of proliferating cells, anticyclin E antibody cross-reacted with a cytoplasmic protein in nonproliferating endothelial cells. This cross-reaction allows the simultaneous visualization and quantitation of microvessels in the tumors, measuring a second potential predictor of breast cancer prognosis, tumor angiogenesis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

To achieve a better understanding of how D5 dopamine receptors mediate the actions of dopamine in brain, we have developed antibodies specific for the D5 receptor. D5 antibodies reacted with recombinant baculovirus-infected Sf9 cells expressing the D5 receptor but not with the D1 receptor or a variety of other catecholaminergic and muscarinic receptors. Epitope-tagged D5 receptors expressed in mammalian cells were reactive with both D5 antibodies and an epitope-specific probe. A mixture of N-linked glycosylated polypeptides and higher molecular-mass species was detected on immunoblots of membrane fractions of D5-transfected cells and also of primate brain. D5 receptor antibodies intensely labeled pyramidal neurons in the prefrontal cortex, whereas spiny medium-sized neurons and aspiny large interneurons of the caudate nucleus were relatively lightly labeled. Antibodies to the D5 dopamine receptor should prove important in experimentally determining specific roles for the D5 and D1 receptors in cortical processes and diseases.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We have explored the localization of the uni chromosome (LG XIX) of Chlamydomonas reinhardtii using the technique of in situ hybridization. Using standardized methods of cell fixation together with large chromosome-specific probes we have studied the position of uni DNA sequences in metaphase and interphase cells. We find that in dividing cells uni probes identify a condensed metaphase chromosome that shows no specialized orientation. In interphase cells uni hybridization signals occur on the anterior edge of the nucleus at a position where basal bodies are normally associated with the nuclear envelope. These data reveal an underlying spatial organization of uni chromosomal DNA within the interphase nucleus that may be significant in terms of the fact that this chromosome encodes numerous functions affecting basal body and flagellar assembly.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.