128 resultados para cell line SCC 25


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Predominant usage of V beta 8.2 gene segments, encoding a T-cell receptor (TCR) beta chain variable region, has been reported for pathogenic Lewis rat T cells reactive to myelin basic protein (MBP). However, up to 75% of the alpha/beta T cells in a panel of MBP-specific T-cell lines did not display TCR V beta 8.2, V beta 8.5, V beta 10, or V beta 16 elements. To further investigate TCR usage, we sorted the T-cell lines for V beta 8.2- and V beta 10-positive T cells or depleted the lines of cells with these TCRs. V beta 8.2-positive T cells and one of the depleted T-cell lines strongly reacted against the MBP peptide MBP-(68-88). The depleted T-cell line caused marked experimental autoimmune encephalomyelitis (EAE) even in Lewis rats in which endogenous V beta 8.2-positive T cells had been eliminated by neonatal treatment with anti-V beta 8.2 monoclonal antibodies. T-cell hybridomas generated from this line predominantly used V beta 3 TCR genes coexpressed with TCR V alpha 2 transcripts, which were also used by V beta 8.2-positive T cells. Furthermore, V beta 10-positive T cells reactive to MBP-(44-67) were encephalitogenic when injected immediately after positive selection. After induction of EAE by sorted V beta 8.2- or V beta 10-positive T-cell lines, immunocytochemical analysis of the spinal cord tissue showed a predominance of the injected TCR or of nontypable alpha/beta T cells after injection of the depleted line. Our results demonstrate heterogeneity of TCR beta-chain usage even for a single autoantigen in an inbred strain. Moreover, V beta 8.2-positive T cells are not essential for the induction and progression of adoptive-transfer EAE.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Poly(ADP-ribose) polymerase [PARP; NAD+ ADP-ribosyltransferase; NAD+:poly(adenosine-diphosphate-D-ribosyl)-acceptor ADP-D-ribosyltransferase, EC 2.4.2.30] is a zinc-dependent eukaryotic DNA-binding protein that specifically recognizes DNA strand breaks produced by various genotoxic agents. To study the biological function of this enzyme, we have established stable HeLa cell lines that constitutively produce the 46-kDa DNA-binding domain of human PARP (PARP-DBD), leading to the trans-dominant inhibition of resident PARP activity. As a control, a cell line was constructed, producing a point-mutated version of the DBD, which has no affinity for DNA in vitro. Expression of the PARP-DBD had only a slight effect on undamaged cells but had drastic consequences for cells treated with genotoxic agents. Exposure of cell lines expressing the wild-type (wt) or the mutated PARP-DBD, with low doses of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) resulted in an increase in their doubling time, a G2 + M accumulation, and a marked reduction in cell survival. However, UVC irradiation had no preferential effect on the cell growth or viability of cell lines expressing the PARP-DBD. These PARP-DBD-expressing cells treated with MNNG presented the characteristic nucleosomal DNA ladder, one of the hallmarks of cell death by apoptosis. Moreover, these cells exhibited chromosomal instability as demonstrated by higher frequencies of both spontaneous and MNNG-induced sister chromatid exchanges. Surprisingly, the line producing the mutated DBD had the same behavior as those producing the wt DBD, indicating that the mechanism of action of the dominant-negative mutant involves more than its DNA-binding function. Altogether, these results strongly suggest that PARP is an element of the G2 checkpoint in mammalian cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Successful gene transfer into stem cells would provide a potentially useful therapeutic modality for treatment of inherited and acquired disorders affecting hematopoietic tissues. Coculture of primate bone marrow cells with retroviral producer cells, autologous stroma, or an engineered stromal cell line expressing human stem cell factor has resulted in a low efficiency of gene transfer as reflected by the presence of 0.1-5% of genetically modified cells in the blood of reconstituted animals. Our experiments in a nonhuman primate model were designed to explore various transduction protocols that did not involve coculture in an effort to define clinically useful conditions and to enhance transduction efficiency of repopulating cells. We report the presence of genetically modified cells at levels ranging from 0.1% (granulocytes) to 14% (B lymphocytes) more than 1 year following reconstitution of myeloablated animals with CD34+ immunoselected cells transduced in suspension culture with cytokines for 4 days with a retrovirus containing the glucocerebrosidase gene. A period of prestimulation for 7 days in the presence of autologous stroma separated from the CD34+ cells by a porous membrane did not appear to enhance transduction efficiency. Infusion of transduced CD34+ cells into animals without myeloablation resulted in only transient appearance of genetically modified cells in peripheral blood. Our results document that retroviral transduction of primate repopulating cells can be achieved without coculture with stroma or producer cells and that the proportion of genetically modified cells may be highest in the B-lymphoid lineage under the given transduction conditions.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Retinoblastoma cells in culture have previously been shown to express cone-specific genes but not their rod counterparts. We have detected the messages for the rod alpha, beta, and gamma subunits of cGMP phosphodiesterase (PDE), the rod alpha subunit of transducin, rod opsin, and the cone alpha' subunit of PDE in RNA of human Y-79 retinoblastoma cells by reverse transcription-PCR. Quantitative analysis of the mRNAs for the rod alpha and cone alpha' PDE subunits revealed that they were expressed at comparable levels; however, the transcript encoding the rod beta PDE subunit was 10 times more abundant in these cells. Northern hybridization analysis of Y-79 cell RNA confirmed the presence of the transcripts for rod and cone PDE catalytic subunits. To test whether the transcriptional machinery required for the expression of rod-specific genes was endogenous in Y-79 retinoblastoma cells, cultures were transfected with a construct containing the promoter region of the rod beta PDE subunit gene attached to the firefly luciferase reporter vector. Significant levels of reporter enzyme activity were observed in the cell lysates. Our results demonstrate that the Y-79 retinoblastoma cell line is a good model system for the study of transcriptional regulation of rod-specific genes.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Mammalian class A macrophage-specific scavenger receptors (SR-A) exhibit unusually broad binding specificity for a wide variety of polyanionic ligands. The properties of these receptors suggest that they may be involved in atherosclerosis and host defense. We have previously observed a similar receptor activity in Drosophila melanogaster embryonic macrophages and in the Drosophila macrophage-like Schneider L2 cell line. Expression cloning was used to isolate from L2 cells a cDNA that encodes a third class (class C) of scavenger receptor, Drosophila SR-CI (dSR-CI). dSR-CI expression was restricted to macrophages/hemocytes during embryonic development. When expressed in mammalian cells, dSR-CI exhibited high affinity and saturable binding of 125I-labeled acetylated low density lipoprotein and mediated its chloroquine-dependent, presumably lysosomal, degradation. Although the broad polyanionic ligand-binding specificity of dSR-CI was similar to that of SR-A, their predicted protein sequences are not similar. dSR-CI is a 609-residue type I integral membrane protein containing several well-known sequence motifs, including two complement control protein (CCP) domains and somatomedin B, MAM, and mucin-like domains. Macrophage scavenger receptors apparently mediate important, well-conserved functions and may be pattern-recognition receptors that arose early in the evolution of host-defense mechanisms. Genetic and physiologic analysis of dSR-CI function in Drosophila should provide further insights into the roles played by scavenger receptors in host defense and development.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.