Identification of human granzyme B promoter regulatory elements interacting with activated T-cell-specific proteins: implication of Ikaros and CBF binding sites in promoter activation.

Granzyme B serine protease is found in the granules of activated cytotoxic T cells and in natural and lymphokine-activated killer cells. This protease plays a critical role in the rapid induction of target cell DNA fragmentation. The DNA regulatory elements that are responsible for the specificity of granzyme B gene transcription in activated T-cells reside between nt -148 and +60 (relative to the transcription start point at +1) of the human granzyme B gene promoter. This region contains binding sites for the transcription factors Ikaros, CBF, Ets, and AP-1. Mutational analysis of the human granzyme B promoter reveals that the Ikaros binding site (-143 to -114) and the AP-1/CBF binding site (-103 to -77) are essential for the activation of transcription in phytohemagglutinin-activated peripheral blood lymphocytes, whereas mutation of the Ets binding site does not affect promoter activity in these cells.

Domains of transcription factor Sp1 required for synergistic activation with sterol regulatory element binding protein 1 of low density lipoprotein receptor promoter.

Feedback regulation of transcription from the low density lipoprotein (LDL) receptor gene is fundamentally important in the maintenance of intracellular sterol balance. The region of the LDL receptor promoter responsible for normal sterol regulation contains adjacent binding sites for the ubiquitous transcription factor Sp1 and the cholesterol-sensitive sterol regulatory element-binding proteins (SREBPs). Interestingly, both are essential for normal sterolmediated regulation of the promoter. The cooperation by Sp1 and SREBP-1 occurs at two steps in the activation process. SREBP-1 stimulates the binding of Sp1 to its adjacent recognition site in the promoter followed by enhanced stimulation of transcription after both proteins are bound to DNA. In the present report, we have defined the protein domains of Sp1 that are required for both synergistic DNA binding and transcriptional activation. The major activation domains of Sp1 that have previously been shown to be essential to activation of promoters containing multiple Sp1 sites are required for activation of the LDL receptor promoter. Additionally, the C domain is also crucial. This slightly acidic approximately 120-amino acid region is not required for efficient synergistic activation by multiple Sp1 sites or in combination with other recently characterized transcriptional regulators. We also show that Sp1 domain C is essential for full, enhanced DNA binding by SREBP-1. Taken together with other recent studies on the role of Sp1 in promoter activation, the current experiments suggest a unique combinatorial mechanism for promoter activation by two distinct transcription factors that are both essential to intracellular cholesterol homeostasis.

The su(Hw) protein bound to gypsy sequences in one chromosome can repress enhancer-promoter interactions in the paired gene located in the other homolog.

The suppressor of Hairy-wing [su(Hw)] protein exerts a polar effect on gene expression by repressing the function of transcriptional enhancers located distally from the promoter with respect to the location of su(Hw) binding sequences. The directionality of this effect suggests that the su(Hw) protein specifically interferes with the basic mechanism of enhancer action. Moreover, mutations in modifier of mdg4 [mod(mdg4)] result in the repression of expression of a gene when the su(Hw) protein is bound to sequences in the copy of this gene located in the homologous chromosome. This effect is dependent on the presence of the su(Hw) binding region from the gypsy retrotransposon in at least one of the chromosomes and is enhanced by the presence of additional gypsy sequences in the other homology. This phenomenon is inhibited by chromosomal rearrangements that disrupt pairing, suggesting that close apposition between the two copies of the affected gene is important for trans repression of transcription. These results indicate that, in the absence of mod-(mdg4) product, the su(Hw) protein present in one chromosome can act in trans and inactivate enhancers located in the other homolog.

Dual transcriptional control by Ear3/COUP: negative regulation through the DR1 direct repeat and positive regulation through a sequence downstream of the transcriptional start site of the mouse mammary tumor virus promoter.

Ear3/COUP is an orphan member of the steroid/thyroid hormone receptor superfamily of transcription factors and binds most tightly to a direct repeat of AGGTCA with 1 nucleotide in between (DR1). Ear3/COUP also binds with a similar affinity to the palindromic thyroid hormone response element (TRE). This binding preference of Ear3/COUP is same as that of the retinoid X receptor (RXR), which is another member of the superfamily. In the present study, we identified a sequence responsible for Ear3/COUP-mediated transactivation in the region downstream of the transcription start site of the mouse mammary tumor virus promoter. This cis-acting sequence was unresponsive to RXR. When the DR1 or TRE sequence was added upstream of the promoter, transactivation by Ear3/COUP was completely abolished, whereas RXR enhanced transcription from the promoter. The mode of action of Ear3/COUP could be utilized to control complex gene expressions in morphogenesis, homeostasis, and development.

A mutation in the promoter of the lipoprotein lipase (LPL) gene in a patient with familial combined hyperlipidemia and low LPL activity.

We have identified a naturally occurring mutation in the promoter of the lipoprotein lipase (LPL) gene. One of 20 patients with familial combined hyperlipidemia (FCHL) and reduced levels of postheparin plasma LPL activity was found to be a heterozygote carrier of this mutation. The mutation, a T-->C substitution at nt -39, occurred in the binding site of the transcription factor Oct-1. As a result, the transcriptional activity of the mutant promoter was < 15% of wild type, as determined by transfection studies in the human macrophage-like cell line THP-1. This decrease in promoter activity was observed in undifferentiated as well as in phorbol ester-differentiated THP-1 cells. Furthermore, the inductive effect of elevating the levels of intracellular cAMP was equally reduced. This mutation was not present among 20 FCHL patients with normal plasma LPL levels nor has it been reported among individuals with familial LPL deficiency. Thus, heterozygosity for LPL promoter mutations may be one of several factors that contribute to the etiology of FCHL.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Promoter architecture in the flagellar regulon of Bacillus subtilis: high-level expression of flagellin by the sigma D RNA polymerase requires an upstream promoter element.

Flagellin is one of the most abundant proteins in motile bacteria, yet its expression requires a low abundance sigma factor (sigma 28). We show that transcription from the Bacillus subtilis flagellin promoter is stimulated 20-fold by an upstream A+T-rich region [upstream promoter (UP) element] both in vivo and in vitro. This UP element is contacted by sigma 28 holoenzyme bound at the flagellin promoter and binds the isolated alpha 2 subassembly of RNA polymerase. The UP element increases the affinity of RNA polymerase for the flagellin promoter and stimulates transcription when initiation is limited by the rate of RNA polymerase binding. Comparison with other promoters in the flagellar regulon reveals a bipartite architecture: the -35 and -10 elements confer specificity for sigma 28, while promoter strength is determined largely by upstream DNA sequences.