125 resultados para ENDOTHELIAL PROGENITOR CELL
Resumo:
Cultured human umbilical vein endothelial cells (EC) constitutively express a low level of CD40 antigen as detected by monoclonal antibody binding and fluorescence flow cytometric quantitation. The level of expression on EC is increased about 3-fold following 24 h treatment with optimal concentrations of tumor necrosis factor, interleukin 1, interferon beta, or interferon gamma; both interferons show greater than additive induction of CD40 when combined with tumor necrosis factor or interleukin 1. Expression of CD40 increases within 8 h of cytokine treatment and continues to increase through 72 h. A trimeric form of recombinant murine CD40 ligand acts on human EC to increase expression of leukocyte adhesion molecules, including E-selectin, vascular cell adhesion molecule 1, and intercellular adhesion molecule 1. CD40 may be detected immunocytochemically on human microvascular EC in normal skin. We conclude that endothelial CD40 may play a role as a signaling receptor in the development of T-cell-mediated inflammatory reactions.
Resumo:
The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.
Resumo:
Wound repair and tumor vascularization depend upon blood vessel growth into hypoxic tissue. Although hypoxia slows endothelial cell (EC) proliferation and suppresses EC basic fibroblast growth factor (bFGF) expression, we report that macrophages (MPs) exposed to PO2 approximately 12-14 torr (1 torr = 133.3 Pa) synthesize and release in a time-dependent manner platelet-derived growth factor (PDGF) and acidic/basic FGFs (a/bFGFs), which stimulate the growth of hypoxic ECs. Chromatography of hypoxic MP-conditioned medium on immobilized heparin with an ascending NaCl gradient resolved three peaks of mitogenic activity: activity of the first peak was neutralized by antibody to PDGF; activity of the second peak was neutralized by antibody to aFGF; and activity of the third peak was neutralized by antibody to bFGF. Metabolically labeled lysates and supernatants from MPs exposed to hypoxia showed increased synthesis and release of immunoprecipitable PDGF and a/bFGF in the absence of changes in cell viability. Possible involvement of a heme-containing oxygen sensor in MP elaboration of growth factors was suggested by the induction of bFGF and PDGF by normoxic MPs exposed to nickel or cobalt, although metabolic inhibitors such as sodium azide were without effect. These results suggest a paracrine model in which hypoxia stimulates MP release of PDGF and a/bFGF, inducing EC proliferation and potentially promoting angiogenesis in hypoxic environments.
Resumo:
Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.