110 resultados para Regulatory T cells


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Many studies have characterized the transmembrane signaling events initiated after T-cell antigen receptor recognition of major histocompatibility complex (MHC)-bound peptides. Yet, little is known about signal transduction from a set of MHC class I recognizing receptors on natural killer (NK) cells whose ligation dramatically inhibits NK cell-mediated killing. In this study we evaluated the influence of MHC recognition on the proximal signaling events in NK cells binding tumor targets. We utilized two experimental models where NK cell-mediated cytotoxicity was fully inhibited by the recognition of specific MHC class I molecules. NK cell binding to either class I-deficient or class I-transfected target cells initiated rapid protein tyrosine kinase activation. In contrast, whereas NK cell binding to class I-deficient targets led to inositol phosphate release and increased intracellular free calcium ([Ca2+]i), NK recognition of class I-bearing targets did not induce the activation of these phospholipase C-dependent signaling events. The recognition of class I by NK cells clearly had a negative regulatory effect since blocking this interaction using anti-class I F(ab')2 fragments increased inositol 1,4,5-trisphosphate release and [Ca2+]i and increased the lysis of the targets. These results suggest that one of the mechanisms by which NK cell recognition of specific MHC class I molecules can block the development of cell-mediated cytotoxicity is by inhibiting specific critical signaling events.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Mast cells are multifunctional bone marrow-derived cells found in mucosal and connective tissues and in the nervous system, where they play important roles in tissue inflammation and in neuroimmune interactions. Very little is known about endogenous molecules and mechanisms capable of modulating mast cell activation. Palmitoylethanolamide, found in peripheral tissues, has been proposed to behave as a local autacoid capable of downregulating mast cell activation and inflammation. A cognate N-acylamide, anandamide, the ethanolamide of arachidonic acid, occurs in brain and is a candidate endogenous agonist for the central cannabinoid receptor (CB1). As a second cannabinoid receptor (CB2) has been found in peripheral tissues, the possible presence of CB2 receptors on mast cells and their interaction with N-acylamides was investigated. Here we report that mast cells express both the gene and a functional CB2 receptor protein with negative regulatory effects on mast cell activation. Although both palmitoylethanolamide and anandamide bind to the CB2 receptor, only the former downmodulates mast cell activation in vitro. Further, the functional effect of palmitoylethanolamide, as well as that of the active cannabinoids, was efficiently antagonized by anandamide. The results suggest that (i) peripheral cannabinoid CB2 receptors control, upon agonist binding, mast cell activation and therefore inflammation; (ii) palmitoylethanolamide, unlike anandamide, behaves as an endogenous agonist for the CB2 receptor on mast cells; (iii) modulatory activities on mast cells exerted by the naturally occurring molecule strengthen a proposed autacoid local inflammation antagonism (ALIA) mechanism; and (iv) palmitoylethanolamide and its derivatives may provide antiinflammatory therapeutic strategies specifically targeted to mast cells ("ALIAmides").

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.