Identification of a minimal sequence of the mouse pro-alpha 1(I) collagen promoter that confers high-level osteoblast expression in transgenic mice and that binds a protein selectively present in osteoblasts.

Based on our previous transgenic mice results, which strongly suggested that separate cell-specific cis-acting elements of the mouse pro-alpha 1(I) collagen promoter control the activity of the gene in different type I collagen-producing cells, we attempted to delineate a short segment in this promoter that could direct high-level expression selectively in osteoblasts. By generating transgenic mice harboring various fragments of the promoter, we identified a 117-bp segment (-1656 to -1540) that is a minimal sequence able to confer high-level expression of a lacZ reporter gene selectively in osteoblasts when cloned upstream of the proximal 220-bp pro-alpha 1(I) promoter. This 220-bp promoter by itself was inactive in transgenic mice and unable to direct osteoblast-specific expression. The 117-bp enhancer segment contained two sequences that appeared to have different functions. The A sequence (-1656 to -1628) was required to obtain expression of the lacZ gene in osteoblasts, whereas the C sequence (-1575 to -1540) was essential to obtain consistent and high-level expression of the lacZ gene in osteoblasts. Gel shift assays showed that the A sequence bound a nuclear protein present only in osteoblastic cells. A mutation in the A segment that abolished the binding of this osteoblast-specific protein also abolished lacZ expression in osteoblasts of transgenic mice.

Discovery of a brain promoter from the human transferrin gene and its utilization for development of transgenic mice that express human apolipoprotein E alleles.

Transgenic mice carrying heterologous genes directed by a 670-bp segment of the regulatory sequence from the human transferrin (TF) gene demonstrated high expression in brain. Mice carrying the chimeric 0.67kbTF-CAT gene expressed TF-CAT in neurons and glial cells of the nucleus basalis, the cerebrum, corpus callosum, cerebellum, and hippocampus. In brains from two independent TF-CAT transgenic founder lines, copy number of TF-CAT mRNA exceeded the number of mRNA transcripts encoding either mouse endogenous transferrin or mouse endogenous amyloid precursor protein. In two transgenic founder lines, the chloramphenicol acetyltransferase (CAT) protein synthesized from the TF-CAT mRNA was estimated to be 0.10-0.15% of the total soluble proteins of the brain. High expression observed in brain indicates that the 0.67kbTF promoter is a promising director of brain expression of heterologous genes. Therefore, the promoter has been used to express the three common human apolipoprotein E (apoE) alleles in transgenic mouse brains. The apoE alleles have been implicated in the expression of Alzheimer disease, and the human apoE isoforms are reported to interact with different affinities to the brain beta-amyloid and tau protein in vitro. Results of this study demonstrate high expression and production of human apoE proteins in transgenic mouse brains. The model may be used to characterize the interaction of human apoE isoforms with other brain proteins and provide information helpful in designing therapeutic strategies for Alzheimer disease.

Mg-SINE: a short interspersed nuclear element from the rice blast fungus, Magnaporthe grisea.

A short interspersed nuclear element, Mg-SINE, was isolated and characterized from the genome of the rice blast fungus, Magnaporthe grisea. Mg-SINE was isolated as an insertion element within Pot2, an inverted-repeat transposon from M. grisea and shows typical features of a mammalian SINE. Mg-SINE is present as a 0.47-kb interspersed sequence at approximately 100 copies per haploid genome in both rice and non-rice isolates of M. grisea, indicating a common evolutionary origin. Secondary structure analysis of Mg-SINE revealed a tRNA-related region at the 5' end which folds into a cloverleaf structure. Genomic fusions resulting in chimeric Mg-SINEs (Ch-SINEs) composed of a sequence homologous to Mg-SINE at the 3' end and an unrelated sequence at its 5' end were also isolated, indicating that this and other DNA rearrangements mediated by these elements may have a major effect on the genomic architecture of this fungus.

Mutational analysis of phytochrome B identifies a small COOH-terminal-domain region critical for regulatory activity.

Overexpression of phytochrome B (phyB) in transgenic Arabidopsis results in enhanced deetiolation in red light. To define domains of phyB functionally important for its regulatory activity, we performed chemical mutagenesis of a phyB-overexpressing line and screened for phenotypic revertants in red light. Four phyB-transgene-linked revertants that retain parental levels of full-length, dimeric, and spectrally normal overexpressed phyB were identified among 101 red-light-specific revertants. All carry single amino acid substitutions in the transgene-encoded phyB that reduce activity by 40- to 1000-fold compared to the nonmutagenized parent. The data indicate that the mutant molecules are fully active in photosignal perception but defective in the regulatory activity responsible for signal transfer to downstream components. All four mutations fall within a 62-residue region in the COOH-terminal domain of phyB, with two independent mutations occurring in a single amino acid, Gly-767. Accumulating evidence indicates that the identified region is a critical determinant in the regulatory function of both phyB and phyA.

Identification and characterization of putative transposable DNA elements in solanaceous plants and Caenorhabditis elegans.

Several families of putative transposable elements (TrEs) in both solanaceous plants and Caenorhabditis elegans have been identified by screening the DNA data base for inverted repeated domains present in multiple copies in the genome. The elements are localized within intron and flanking regions of many genes. These elements consist of two inverted repeats flanking sequences ranging from 5 bp to > 500 bp. Identification of multiple elements in which sequence conservation includes both the flanking and internal regions implies that these TrEs are capable of duplicative transposition. Two of the elements were identified in promoter regions of the tomato (Lycoperiscon esculentum) polygalacturonase and potato (Solanum tuberosum) Win1 genes. The element in the polygalacturonase promoter spans a known regulatory region. In both cases, ancestral DNA sequences, which represent potential recombination target sequences prior to insertion of the elements, have been cloned from related species. The sequences of the inverted repeated domains in plants and C. elegans show a high degree of phylogenetic conservation. While frequency of the different elements is variable, some are present in very high copy number. A member of a single C. elegans TrE family is observed approximately once every 20 kb in the genome. The abundance of the described TrEs suggests utility in the genomic analysis of these and related organisms.

Identification of auxin-responsive elements of parB and their expression in apices of shoot and root.

Detailed analysis of transgenic tobaccos containing a series of chimeric parB promoter/beta-glucuronidase (GUS) gene constructs allowed us to define two auxin-responsive elements (AREs) of 48 bp and 95 bp (positions -210 to -163 and -374 to -280) in the parB promoter. The two AREs responded independently to physiological concentrations of auxin. Gel retardation assays revealed binding of nuclear protein(s) to the sequence conserved between ARE I and ARE II. The auxin responsiveness of the parB promoter did not mediate the pathway through the as-1 element and transcription factor ASF-1. AREs I and II were responsive to auxin at physiological concentrations, whereas as-1 responded only to higher concentrations of auxin which may be interpreted as stress, though as-1 had been reported to be a minimal ARE [Liu, X. & Lam, E. (1994) J. Biol. Chem. 269, 668-675]. Histochemical staining of transgenic tobacco that contained a parB promoter/GUS construct demonstrated the expression of GUS activity in the shoot apex as well as in the root tips, suggesting the involvement of parB expression in meristematic activity or differentiation. The drastic change in auxin responsiveness in the transgenic plants between the 6th and 10th day after imbibition of seeds implies the development or the activation of auxin signal transduction systems during plant development.

Delineation of a slow-twitch-myofiber-specific transcriptional element by using in vivo somatic gene transfer.

Contractile proteins are encoded by multigene families, most of whose members are differentially expressed in fast- versus slow-twitch myofibers. This fiber-type-specific gene regulation occurs by unknown mechanisms and does not occur within cultured myocytes. We have developed a transient, whole-animal assay using somatic gene transfer to study this phenomenon and have identified a fiber-type-specific regulatory element within the promoter region of a slow myofiber-specific gene. A plasmid-borne luciferase reporter gene fused to various muscle-specific contractile gene promoters was differentially expressed when injected into slow- versus fast-twitch rat muscle: the luciferase gene was preferentially expressed in slow muscle when fused to a slow troponin I promoter, and conversely, was preferentially expressed in fast muscle when fused to a fast troponin C promoter. In contrast, the luciferase gene was equally well expressed by both muscle types when fused to a nonfiber-type-specific skeletal actin promoter. Deletion analysis of the troponin I promoter region revealed that a 157-bp enhancer conferred slow-muscle-preferential activity upon a minimal thymidine kinase promoter. Transgenic analysis confirmed the role of this enhancer in restricting gene expression to slow-twitch myofibers. Hence, somatic gene transfer may be used to rapidly define elements that direct myofiber-type-specific gene expression prior to the generation of transgenic mice.

Involvement of small GTP-binding proteins in defense signal-transduction pathways of higher plants.

Small GTP-binding proteins play a critical role in the regulation of a range of cellular processes--including growth, differentiation, and intracellular transportation. Previously, we isolated a gene, rgp1, encoding a small GTP-binding protein, by differential screening of a rice cDNA library with probe DNAs from rice tissues treated with or without 5-azacytidine, a powerful inhibitor of DNA methylation. To determine the physiological role of rgp1, the coding region was introduced into tobacco plants. Transformants, with rgp1 in either sense or antisense orientations, showed distinct phenotypic changes with reduced apical dominance, dwarfism, and abnormal flower development. These abnormal phenotypes appeared to be associated with the higher levels of endogenous cytokinins that were 6-fold those of wild-type plants. In addition, the transgenic plants produced salicylic acid and salicylic acid-beta-glucoside in an unusual response to wounding, thus conferring increased resistance to tobacco mosaic virus infection. In normal plants, the wound- and pathogen-induced signal-transduction pathways are considered to function independently. However, the wound induction of salicylic acid in the transgenic plants suggests that expression of rgp1 somehow interfered with the normal signaling pathways and resulted in cross-signaling between these distinct transduction systems. The results imply that the defense signal-transduction system consists of a complicated and finely tuned network of several regulatory factors, including cytokinins, salicylic acid, and small GTP-binding proteins.

Human von Willebrand factor gene sequences target expression to a subpopulation of endothelial cells in transgenic mice.

The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.

Chicken interferon consensus sequence-binding protein (ICSBP) and interferon regulatory factor (IRF) 1 genes reveal evolutionary conservation in the IRF gene family.

Members of the IRF family mediate transcriptional responses to interferons (IFNs) and to virus infection. So far, proteins of this family have been studied only among mammalian species. Here we report the isolation of cDNA clones encoding two members of this family from chicken, interferon consensus sequence-binding protein (ICSBP) and IRF-1. The predicted chicken ICSBP and IRF-1 proteins show high levels of sequence similarity to their corresponding human and mouse counterparts. Sequence identities in the putative DNA-binding domains of chicken and human ICSBP and IRF-1 were 97% and 89%, respectively, whereas the C-terminal regions showed identities of 64% and 51%; sequence relationships with mouse ICSBP and IRF-1 are very similar. Chicken ICSBP was found to be expressed in several embryonic tissues, and both chicken IRF-1 and ICSBP were strongly induced in chicken fibroblasts by IFN treatment, supporting the involvement of these factors in IFN-regulated gene expression. The presence of proteins homologous to mammalian IRF family members, together with earlier observations on the occurrence of functionally homologous IFN-responsive elements in chicken and mammalian genes, highlights the conservation of transcriptional mechanisms in the IFN system, a finding that contrasts with the extensive sequence and functional divergence of the IFNs.

Conditional transformation of a pancreatic beta-cell line derived from transgenic mice expressing a tetracycline-regulated oncogene.

Conditional oncogene expression in transgenic mice is of interest for studying the oncoprotein requirements during tumorigenesis and for deriving cell lines that can be induced to undergo growth arrest and enhance their differentiated functions. We utilized the bacterial tetracycline (Tet)-resistance operon regulatory system (tet) from Tn10 of Escherichia coli to control simian virus 40 (SV40) large tumor (T) antigen (TAg) gene expression and to generate conditionally transformed pancreatic beta cells in transgenic mice. A fusion protein containing the tet repressor (tetR) and the activating domain of the herpes simplex virus protein VP16, which converts the repressor into a transcription activator, was produced in beta cells of transgenic mice under control of the insulin promoter. In a separate lineage of transgenic mice, the TAg gene was introduced under control of a tandem array of tet operator sequences and a minimal promoter, which by itself is not sufficient for gene expression. Mice from the two lineages were then crossed to generate double-transgenic mice. Expression of the tetR fusion protein in beta cells activated TAg transcription, resulting in the development of beta-cell tumors. Tumors arising in the absence of Tet were cultured to derive a stable beta-cell line. Cell incubation in the presence of Tet led to inhibition of proliferation, as shown by decreased BrdUrd and [3H]thymidine incorporation. The Tet derivative anhydrotetracycline showed a 100-fold stronger inhibition compared with Tet. When administered in vivo, Tet efficiently inhibited beta-cell proliferation. These findings indicate that transformed beta cells selected for growth during a tumorigenesis process in vivo maintain a dependence on the continuous presence of the TAg oncoprotein for their proliferation. This system provides an approach for generation of beta-cell lines for cell therapy of diabetes as well as conditionally transformed cell lines from other cell types of interest.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.