116 resultados para Neurotrophic Gene Factor
Resumo:
The application of DNA technology to regulate the transcription of disease-related genes in vivo has important therapeutic potentials. The transcription factor E2F plays a pivotal role in the coordinated transactivation of cell cycle-regulatory genes such as c-myc, cdc2, and the gene encoding proliferating-cell nuclear antigen (PCNA) that are involved in lesion formation after vascular injury. We hypothesized that double-stranded DNA with high affinity for E2F may be introduced in vivo as a decoy to bind E2F and block the activation of genes mediating cell cycle progression and intimal hyperplasia after vascular injury. Gel mobility-shift assays showed complete competition for E2F binding protein by the E2F decoy. Transfection with E2F decoy inhibited expression of c-myc, cdc2, and the PCNA gene as well as vascular smooth muscle cell proliferation both in vitro and in the in vivo model of rat carotid injury. Furthermore, 2 weeks after in vivo transfection, neointimal formation was significantly prevented by the E2F decoy, and this inhibition continued up to 8 weeks after a single transfection in a dose-dependent manner. Transfer of an E2F decoy can therefore modulate gene expression and inhibit smooth muscle proliferation and vascular lesion formation in vivo.
Resumo:
Within the central nervous system (CNS) ciliary neurotrophic factor (CNTF) is expressed by astrocytes where it remains stored as an intracellular protein; its release and function as an extracellular ligand are thought to occur in the event of cellular injury. We find that overexpression of CNTF in transgenic mice recapitulates the glial response to CNS lesion, as does its injection into the uninjured brain. These results demonstrate that CNTF functions as an inducer of reactive gliosis, a condition associated with a number of neurological diseases of the CNS.
Resumo:
To compare effects of insulin-like growth factor I (IGF-I) and placebo treatment on lesions that resemble those seen during active demyelination in multiple sclerosis, we induced experimental autoimmune encephalomyelitis in Lewis rats with an emulsion containing guinea pig spinal cord and Freund's adjuvant. On day 12-13, pairs of rats with the same degree of weakness were given either IGF-I or placebo intravenously twice daily for 8 days. After 8 days of placebo or IGF-I (200 micrograms/day or 1 mg/day) treatment, the spinal cord lesions were studied by in situ hybridization and with immunocytochemical and morphological methods. IGF-I produced significant reductions in numbers and areas of demyelinating lesions. These lesions contained axons surrounded by regenerating myelin segments instead of demyelinated axons seen in the placebo-treated rats. Relative mRNA levels for myelin basic protein, proteolipid protein (PLP), and 2',3'-cyclic nucleotide 3'-phosphodiesterase in lesions of IGF-I-treated rats were significantly higher than they were in placebo-treated rats. PLP mRNA-containing oligodendroglia also were more numerous and relative PLP mRNA levels per oligodendrocyte were higher in lesions of IGF-I-treated rats. Finally, a significantly higher proportion of proliferating cells were oligodendroglia-like cells in lesions of IGF-I-treated rats. We think that IGF-I effects on oligodendrocytes, myelin protein synthesis, and myelin regeneration reduced lesion severity and promoted clinical recovery in this experimental autoimmune encephalomyelitis model. These IGF-I actions may also benefit patients with multiple sclerosis.
Resumo:
Members of the winged helix/forkhead family of transcription factors are believed to play a role in cell-specific gene expression. A cDNA encoding a member of this family of proteins, termed hepatocyte nuclear factor/forkhead homologue 4 (HFH-4), has been isolated from rat lung and rat testis cDNA libraries. This cDNA contains an open reading frame of 421 amino acids with a conserved DNA binding domain and several potential transactivating regions. During murine lung development, a single species of HFH-4-specific transcript (2.4 kb long) is first detected precisely at the start of the late pseudoglandular stage (embryonic day 14.5) and, by in situ hybridization, is specifically localized to the proximal pulmonary epithelium. The unique temporal and spatial pattern of HFH-4 gene expression in the developing lung defines this protein as a marker for the initiation of bronchial epithelial cell differentiation and suggests that it may play an important role in cell fate determination during lung development. In addition to expression in the pulmonary epithelium, RNA blot analysis reveals 2.4-kb HFH-4 transcripts in the testis and oviduct. By using mice with genetic defects in spermatogenesis, HFH-4 expression in the testis is found to be associated with the appearance of haploid germ cells and in situ hybridization studies indicate that HFH-4 expression is confined to stages I-VII of spermatogenesis. This pattern of HFH-4 gene expression during the early stages of differentiation of haploid germ cells suggests that HFH-4 may play a role in regulating stage-specific gene expression and cell-fate determination during lung development and in spermatogenesis.
Resumo:
The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.
Resumo:
In aerobic organisms, protection against oxidative damage involves the combined action of highly specialized antioxidant enzymes, such as superoxide dismutase (SOD) and catalase. Here we describe the isolation and characterization of another gene in the yeast Saccharomyces cerevisiae that plays a critical role in detoxification of reactive oxygen species. This gene, named ATX1, was originally isolated by its ability to suppress oxygen toxicity in yeast lacking SOD. ATX1 encodes a 8.2-kDa polypeptide exhibiting significant similarity and identity to various bacterial metal transporters. Potential ATX1 homologues were also identified in multicellular eukaryotes, including the plants Arabidopsis thaliana and Oryza sativa and the nematode Caenorhabditis elegans. In yeast cells, ATX1 evidently acts in the transport and/or partitioning of copper, and this role in copper homeostasis appears to be directly relevant to the ATX1 suppression of oxygen toxicity: ATX1 was incapable of compensating for SOD when cells were depleted of exogenous copper. Strains containing a deletion in the chromosomal ATX1 locus were generated. Loss of ATX1 function rendered both mutant and wild-type SOD strains hypersensitive toward paraquat (a generator of superoxide anion) and was also associated with an increased sensitivity toward hydrogen peroxide. Hence, ATX1 protects cells against the toxicity of both superoxide anion and hydrogen peroxide.
Resumo:
Members of the IRF family mediate transcriptional responses to interferons (IFNs) and to virus infection. So far, proteins of this family have been studied only among mammalian species. Here we report the isolation of cDNA clones encoding two members of this family from chicken, interferon consensus sequence-binding protein (ICSBP) and IRF-1. The predicted chicken ICSBP and IRF-1 proteins show high levels of sequence similarity to their corresponding human and mouse counterparts. Sequence identities in the putative DNA-binding domains of chicken and human ICSBP and IRF-1 were 97% and 89%, respectively, whereas the C-terminal regions showed identities of 64% and 51%; sequence relationships with mouse ICSBP and IRF-1 are very similar. Chicken ICSBP was found to be expressed in several embryonic tissues, and both chicken IRF-1 and ICSBP were strongly induced in chicken fibroblasts by IFN treatment, supporting the involvement of these factors in IFN-regulated gene expression. The presence of proteins homologous to mammalian IRF family members, together with earlier observations on the occurrence of functionally homologous IFN-responsive elements in chicken and mammalian genes, highlights the conservation of transcriptional mechanisms in the IFN system, a finding that contrasts with the extensive sequence and functional divergence of the IFNs.
Resumo:
RB, the protein product of the retinoblastoma tumor-suppressor gene, regulates the activity of specific transcription factors. This regulation appears to be mediated either directly through interactions with specific transcription factors or through an alternative mechanism. Here we report that stimulation of Sp1-mediated transcription by RB is partially abrogated at the nonpermissive temperature in ts13 cells. These cells contain a temperature-sensitive mutation in the TATA-binding protein-associated factor TAFII250, first identified as the cell cycle regulatory protein CCG1. The stimulation of Sp1-mediated transcription by RB in ts13 cells at the nonpermissive temperature could be restored by the introduction of wild-type human TAFII250. Furthermore, we demonstrate that RB binds directly to hTAFII250 in vitro and in vivo. These results suggest that RB can confer transcriptional regulation and possibly cell cycle control and tumor suppression through an interaction with TFIID, in particular with TAFII250.
Resumo:
Mutations in the Saccharomyces cerevisiae SSU71 gene were isolated as suppressors of a transcription factor TFIIB defect that confers both a cold-sensitive growth defect and a downstream shift in transcription start-site selection at the cyc1 locus. The ssu71-1 suppressor not only suppresses the conditional phenotype but also restores the normal pattern of transcription initiation at cyc1. In addition, the ssu71-1 suppressor confers a heat-sensitive phenotype that is dependent upon the presence of the defective form of TFIIB. Molecular and genetic analysis of the cloned SSU71 gene demonstrated that SSU71 is a single-copy essential gene encoding a highly charged protein with a molecular mass of 82,194 daltons. Comparison of the deduced Ssu71 amino acid sequence with the protein data banks revealed significant similarity to RAP74, the larger subunit of the human general transcription factor TFIIF. Moreover, Ssu71 is identical to p105, a component of yeast TFIIF. Taken together, these data demonstrate a functional interaction between TFIIB and the large subunit of TFIIF and that this interaction can affect start-site selection in vivo.
Resumo:
Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.