110 resultados para FACTOR-XII GENE


Relevância:

40.00% 40.00%

Publicador:

Resumo:

Members of the IRF family mediate transcriptional responses to interferons (IFNs) and to virus infection. So far, proteins of this family have been studied only among mammalian species. Here we report the isolation of cDNA clones encoding two members of this family from chicken, interferon consensus sequence-binding protein (ICSBP) and IRF-1. The predicted chicken ICSBP and IRF-1 proteins show high levels of sequence similarity to their corresponding human and mouse counterparts. Sequence identities in the putative DNA-binding domains of chicken and human ICSBP and IRF-1 were 97% and 89%, respectively, whereas the C-terminal regions showed identities of 64% and 51%; sequence relationships with mouse ICSBP and IRF-1 are very similar. Chicken ICSBP was found to be expressed in several embryonic tissues, and both chicken IRF-1 and ICSBP were strongly induced in chicken fibroblasts by IFN treatment, supporting the involvement of these factors in IFN-regulated gene expression. The presence of proteins homologous to mammalian IRF family members, together with earlier observations on the occurrence of functionally homologous IFN-responsive elements in chicken and mammalian genes, highlights the conservation of transcriptional mechanisms in the IFN system, a finding that contrasts with the extensive sequence and functional divergence of the IFNs.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

RB, the protein product of the retinoblastoma tumor-suppressor gene, regulates the activity of specific transcription factors. This regulation appears to be mediated either directly through interactions with specific transcription factors or through an alternative mechanism. Here we report that stimulation of Sp1-mediated transcription by RB is partially abrogated at the nonpermissive temperature in ts13 cells. These cells contain a temperature-sensitive mutation in the TATA-binding protein-associated factor TAFII250, first identified as the cell cycle regulatory protein CCG1. The stimulation of Sp1-mediated transcription by RB in ts13 cells at the nonpermissive temperature could be restored by the introduction of wild-type human TAFII250. Furthermore, we demonstrate that RB binds directly to hTAFII250 in vitro and in vivo. These results suggest that RB can confer transcriptional regulation and possibly cell cycle control and tumor suppression through an interaction with TFIID, in particular with TAFII250.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Mutations in the Saccharomyces cerevisiae SSU71 gene were isolated as suppressors of a transcription factor TFIIB defect that confers both a cold-sensitive growth defect and a downstream shift in transcription start-site selection at the cyc1 locus. The ssu71-1 suppressor not only suppresses the conditional phenotype but also restores the normal pattern of transcription initiation at cyc1. In addition, the ssu71-1 suppressor confers a heat-sensitive phenotype that is dependent upon the presence of the defective form of TFIIB. Molecular and genetic analysis of the cloned SSU71 gene demonstrated that SSU71 is a single-copy essential gene encoding a highly charged protein with a molecular mass of 82,194 daltons. Comparison of the deduced Ssu71 amino acid sequence with the protein data banks revealed significant similarity to RAP74, the larger subunit of the human general transcription factor TFIIF. Moreover, Ssu71 is identical to p105, a component of yeast TFIIF. Taken together, these data demonstrate a functional interaction between TFIIB and the large subunit of TFIIF and that this interaction can affect start-site selection in vivo.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.