108 resultados para Cell Line
Resumo:
We report characterization of a human T-cell lymphotropic virus type II (HTLV-II) isolated from an interleukin 2-dependent CD8 T-cell line derived from peripheral blood mononuclear cells of a healthy, HTLV-II-seropositive female Bakola Pygmy, aged 59, living in a remote equatorial forest area in south Cameroon. This HTLLV-II isolate, designated PYGCAM-1, reacted in an indirect immunofluorescence assay with HTLV-II and HTLV-I polyclonal antibodies and with an HTLV-I/II gp46 monoclonal antibody but not with HTLV-I gag p19 or p24 monoclonal antibodies. The cell line produced HTLV-I/II p24 core antigen and retroviral particles. The entire env gene (1462 bp) and most of the long terminal repeat (715 bp) of the PYGCAM-1 provirus were amplified by the polymerase chain reaction using HTLV-II-specific primers. Comparison with the long terminal repeat and envelope sequences of prototype HTLV-II strains indicated that PYGCAM-1 belongs to the subtype B group, as it has only 0.5-2% nucleotide divergence from HTLV-II B strains. The finding of antibodies to HTLV-II in sera taken from the father of the woman in 1984 and from three unrelated members of the same population strongly suggests that PYGCAM-1 is a genuine HTLV-II that has been present in this isolated population for a long time. The low genetic divergence of this African isolate from American isolates raises questions about the genetic variability over time and the origin and dissemination of HTLV-II, hitherto considered to be predominantly a New World virus.
Resumo:
Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.