147 resultados para TATA box basal promoter element


Relevância:

40.00% 40.00%

Publicador:

Resumo:

Sterol-regulated transcription of the gene for rat farnesyl diphosphate (FPP) synthase (geranyl-diphosphate:isopentenyl-diphosphate geranyltranstransferase, EC 2.5.1.10) is dependent in part on the binding of the ubiquitous transcription factor NF-Y to a 6-bp element within the proximal promoter. Current studies identify a second element in this promoter that is also required for sterol-regulated transcription in vivo. Mutation of three nucleotides (CAC) within this element blocks the 8-fold induction of FPP synthase promoter-reporter genes that normally occurs when the transfected cells are incubated in medium deprived of sterols. Gel mobility-shift assays demonstrate that the transcriptionally active 68-kDa fragment of the sterol regulatory element (SRE-1)-binding protein assays (SREBP-1) binds to an oligonucleotide containing the wild-type sequence but not to an oligonucleotide in which the CAC has been mutated. DNase 1 protection pattern (footprint) analysis indicates that SREBP-1 binds to nucleotides that include the CAC. Both the in vivo and in vitro assays are affected by mutagenesis of nucleotides adjacent to the CAC. Coexpression of SREBP with a wild-type FPP synthase promoter-reporter gene in CV-1 cells results in very high levels of reporter activity that is sterol-independent. In contrast, the reporter activity remained low when the promoter contained a mutation in the CAC trinucleotide. We conclude that sterol-regulated transcription of FPP synthase is controlled in part by the interaction of SREBP with a binding site that we have termed SRE-3. Identification of this element may prove useful in the identification of other genes that are both regulated by SREBP and involved in lipid biosynthesis.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The cystic fibrosis transmembrane conductance regulator (CFTR) functions as a Cl- channel that becomes activated after phosphorylation by cAMP-dependent protein kinase (PKA). We demonstrate that PKA also plays a crucial role in maintaining basal expression of the CFTR gene in the human colon carcinoma cell line T84. Inhibition of PKA activity by expression of a dominant-negative regulatory subunit or treatment with the PKA-selective inhibitor N-[2-(p-bromocinnamylamino)ethyl]-5-isoquinolinesulfonamide (H-89) caused a complete suppression of CFTR gene expression without affecting other constitutively active genes. Basal expression of a 2.2-kb region of the CFTR promoter linked to a luciferase reporter gene (CFTR-luc) exhibited the same dependence on PKA. The ability of cAMP to induce CFTR over basal levels is cell-type specific. In T84 cells, both the endogenous CFTR gene and CFTR-luc exhibited only a modest inducibility (approximately 2-fold), whereas in the human choriocarcinoma cell line JEG-3, CFTR-luc could be induced at least 4-fold. A variant cAMP-response element is present at position -48 to -41 in the CFTR promoter, and mutation of this sequence blocks basal expression. We conclude that cAMP, acting through PKA, is an essential regulator of basal CFTR gene expression and may mediate an induction of CFTR in responsive cell types.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Feedback regulation of transcription from the low density lipoprotein (LDL) receptor gene is fundamentally important in the maintenance of intracellular sterol balance. The region of the LDL receptor promoter responsible for normal sterol regulation contains adjacent binding sites for the ubiquitous transcription factor Sp1 and the cholesterol-sensitive sterol regulatory element-binding proteins (SREBPs). Interestingly, both are essential for normal sterolmediated regulation of the promoter. The cooperation by Sp1 and SREBP-1 occurs at two steps in the activation process. SREBP-1 stimulates the binding of Sp1 to its adjacent recognition site in the promoter followed by enhanced stimulation of transcription after both proteins are bound to DNA. In the present report, we have defined the protein domains of Sp1 that are required for both synergistic DNA binding and transcriptional activation. The major activation domains of Sp1 that have previously been shown to be essential to activation of promoters containing multiple Sp1 sites are required for activation of the LDL receptor promoter. Additionally, the C domain is also crucial. This slightly acidic approximately 120-amino acid region is not required for efficient synergistic activation by multiple Sp1 sites or in combination with other recently characterized transcriptional regulators. We also show that Sp1 domain C is essential for full, enhanced DNA binding by SREBP-1. Taken together with other recent studies on the role of Sp1 in promoter activation, the current experiments suggest a unique combinatorial mechanism for promoter activation by two distinct transcription factors that are both essential to intracellular cholesterol homeostasis.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The transactivation activity of the p53 tumor suppressor protein is critical for regulating cell growth and apoptosis. We describe the identification of a transcription factor that is functionally similar to p53 and contains the same DNA binding and transcription activities specific for the p53 responsive DNA element (p53RE). This protein was highly purified through chromatography from HeLa cell extracts. The purified protein was able to bind specifically to the p53RE derived from a p21waf1 promoter and to stimulate p53RE-dependent transcription but not basal transcription in vitro. Its DNA-binding activity was inhibited by the wild type but not mutant p53RE-containing DNA oligomers. Also, this p53RE-binding activity was found in human p53 null Saos-2 osteosarcoma and H1299 small cell lung carcinoma cells. Interestingly, this activity exhibited a p53RE sequence preference that was distinct from the p53 protein. The activity is neither p53 nor p73, because anti-p53 or anti-73 antibodies were unable to detect this purified protein nor were the antibodies able to alter the p53-like activity, the p53RE-protein complex. These results demonstrate that, besides p73, an additional p53-like protein exists in cells, which is named NBP for non-p53, p53RE binding protein.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

To investigate the regulation of the human fatty acid synthase gene by the thyroid hormone triiodothyronine, various constructs of the human fatty acid synthase promoter and the luciferase reporter gene were transfected in combination with plasmids expressing the thyroid hormone and the retinoid X receptors in HepG2 cells. The reporter gene was activated 25-fold by the thyroid hormone in the presence of the thyroid hormone receptor. When both the thyroid hormone and the retinoid X receptors were expressed in HepG2 cells, there was about a 100-fold increase in reporter gene expression. 5′-Deletion analysis disclosed two thyroid hormone response elements, TRE1 (nucleotides −870 to −650) and TRE2 (nucleotides −272 to −40), in the human fatty acid synthase promoter. The presence of thyroid hormone response elements in these two regions of the promoter was confirmed by cloning various fragments of these two regions in the minimal thymidine kinase promoter−luciferase reporter gene plasmid construct and determining reporter gene expression. The results of this cloning procedure and those of electrophoretic mobility shift assays indicated that the sequence GGGTTAcgtcCGGTCA (nucleotides −716 to −731) represents TRE1 and that the sequence GGGTCC (nucleotides −117 to −112) represents TRE2. The sequence of TRE1 is very similar to the consensus sequence of the thyroid hormone response element, whereas the sequence of TRE2 contains only a half-site of the thyroid hormone response element consensus motif because it lacks the direct repeat. The sequences on either side of TRE2 seem to influence its response to the thyroid hormone and retinoid X receptors.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Calbindin D28 encodes a calcium binding protein that is expressed in the cerebellum exclusively in Purkinje cells. We have used biolistic transfection of organotypic slices of P12 cerebellum to identify a 40-bp element from the calbindin promoter that is necessary and sufficient for Purkinje cell specific expression in this transient in situ assay. This element (PCE1) is also present in the calmodulin II promoter, which regulates expression of a second Purkinje cell Ca2+ binding protein. Expression of high levels of exogenous calbindin or calretinin decreased transcription mediated by PCE1 in Purkinje cells 2.5- to 3-fold, whereas the presence of 1 μM ionomycin in the extracellular medium increased expression. These results demonstrate that PCE1 is a component of a cell-specific and Ca2+-sensitive transcriptional regulatory mechanism that may play a key role in setting the Ca2+ buffering capacity of Purkinje cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Receptors coupled to heterotrimeric G proteins can effectively stimulate growth promoting pathways in a large variety of cell types, and if persistently activated, these receptors can also behave as dominant-acting oncoproteins. Consistently, activating mutations for G proteins of the Gαs and Gαi2 families were found in human tumors; and members of the Gαq and Gα12 families are fully transforming when expressed in murine fibroblasts. In an effort aimed to elucidate the molecular events involved in proliferative signaling through heterotrimeric G proteins we have focused recently on gene expression regulation. Using NIH 3T3 fibroblasts expressing m1 muscarinic acetylcholine receptors as a model system, we have observed that activation of this transforming G protein-coupled receptors induces the rapid expression of a variety of early responsive genes, including the c-fos protooncogene. One of the c-fos promoter elements, the serum response element (SRE), plays a central regulatory role, and activation of SRE-dependent transcription has been found to be regulated by several proteins, including the serum response factor and the ternary complex factor. With the aid of reporter plasmids for gene expression, we observed here that stimulation of m1 muscarinic acetylcholine receptors potently induced SRE-driven reporter gene activity in NIH 3T3 cells. In these cells, only the Gα12 family of heterotrimeric G protein α subunits strongly induced the SRE, while Gβ1γ2 dimers activated SRE to a more limited extent. Furthermore, our study provides strong evidence that m1, Gα12 and the small GTP-binding protein RhoA are components of a novel signal transduction pathway that leads to the ternary complex factor-independent transcriptional activation of the SRE and to cellular transformation.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Caveolae form the terminus for a major pathway of intracellular free cholesterol (FC) transport. Caveolin mRNA levels in confluent human skin fibroblasts were up-regulated following increased uptake of low density lipoprotein (LDL) FC. The increase induced by FC was not associated with detectable change in mRNA stability, indicating that caveolin mRNA levels were mediated at the level of gene transcription. A total of 924 bp of 5′ flanking region of the caveolin gene were cloned and sequenced. The promoter sequence included three G+C-rich potential sterol regulatory elements (SREs), a CAAT sequence and a Sp1 consensus sequence. Deletional mutagenesis of individual SRE-like sequences indicated that of these two (at −646 and −395 bp) were essential for the increased transcription rates mediated by LDL-FC, whereas the third was inconsequential. Gel shift analysis of protein binding from nuclear extracts to these caveolin promoter DNA sequences, together with DNase I footprinting, confirmed nucleoprotein binding to the SRE-like elements as part of the transcriptional response to LDL-FC. A supershift obtained with antibody to SRE-binding protein 1 (SPEBP-1) indicated that this protein binds at −395 bp. There was no reaction at −395 bp with anti-Sp1 antibody nor with either antibody at −646 bp. The cysteine protease inhibitor N-acetyl-leu-leu-norleucinal (ALLN), which inhibits SREBP catabolism, superinhibited caveolin mRNA levels regardless of LDL-FC. This finding suggests that SREBP inhibits caveolin gene transcription in contrast to its stimulating effect on other promoters. The findings of this study are consistent with the postulated role for caveolin as a regulator of cellular FC homeostasis in quiescent peripheral cells, and the coordinate regulation by SREBP of FC influx and efflux.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The association of the TATA binding protein (TBP) to eukaryotic promoters is a possible rate-limiting step in gene expression. Slow promoter binding might be related to TBP’s ability to occlude its DNA binding domain through dimerization. Using a “pull-down” based assay, we find that TBP dimers dissociate slowly (t½ = 6–10 min), and thus present a formidable kinetic barrier to TATA binding. At 10 nM, TBP appears to exist as a mixed population of monomers and dimers. In this state, TATA binding displays burst kinetics that appears to reflect rapid binding of monomers and slow dissociation of dimers. The kinetics of the slow phase is in excellent agreement with direct measurements of the kinetics of dimer dissociation.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Transforming growth factor β (TGF-β) regulates a broad range of biological processes, including cell growth, development, differentiation, and immunity. TGF-β signals through its cell surface receptor serine kinases that phosphorylate Smad2 or Smad3 proteins. Because Smad3 and its partner Smad4 bind to only 4-bp Smad binding elements (SBEs) in DNA, a central question is how specificity of TGF-β-induced transcription is achieved. We show that Smad3 selectively binds to two of the three SBEs in PE2.1, a TGF-β-inducible fragment of the plasminogen activator inhibitor-1 promoter, to mediate TGF-β-induced transcription; moreover, a precise 3-bp spacer between one SBE and the E-box, a binding site for transcription factor μE3 (TFE3), is essential for TGF-β-induced transcription. Whereas an isolated Smad3 MH1 domain binds to TFE3, TGF-β receptor-mediated phosphorylation of full-length Smad3 enhances its binding to TFE3. Together, these studies elucidate an important mechanism for specificity in TGF-β-induced transcription of the plasminogen activator inhibitor-1 gene.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The TATA-binding protein (TBP)-related factor TRF1, has been described in Drosophila and a related protein, TRF2, has been found in a variety of higher eukaryotes. We report that human (h)TRF2 is encoded by two mRNAs with common protein coding but distinct 5′ nontranslated regions. One mRNA is expressed ubiquitously (hTRF2-mRNA1), whereas the other (hTRF2-mRNA2) shows a restricted expression pattern and is extremely abundant in testis. In addition, we show that hTRF2 forms a stable stoichiometric complex with hTFIIA, but not with TAFs, in HeLa cells stably transfected with flag-tagged hTRF2. Neither recombinant human (rh)TRF2 nor the native flag⋅hTRF2-TFIIA complex is able to replace TBP or TFIID in basal or activated transcription from various RNA polymerase II promoters. Instead, rhTRF2, but not the flag⋅hTRF2–TFIIA complex, moderately inhibits basal or activated transcription in the presence of rhTBP or flag⋅TFIID. This effect is either completely (TBP-mediated transcription) or partially (TFIID-mediated transcription) counteracted by addition of free TFIIA. Neither rhTRF2 nor flag⋅hTRF2–TFIIA has any effect on the repression of TFIID-mediated transcription by negative cofactor-2 (NC2) and neither substitutes for TBP in RNA polymerase III-mediated transcription.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

To create a universal system for the control of gene expression, we have studied methods for the construction of novel polydactyl zinc finger proteins that recognize extended DNA sequences. Elsewhere we have described the generation of zinc finger domains recognizing sequences of the 5′-GNN-3′ subset of a 64-member zinc finger alphabet. Here we report on the use of these domains as modular building blocks for the construction of polydactyl proteins specifically recognizing 9- or 18-bp sequences. A rapid PCR assembly method was developed that, together with this predefined set of zinc finger domains, provides ready access to 17 million novel proteins that bind the 5′-(GNN)6-3′ family of 18-bp DNA sites. To examine the efficacy of this strategy in gene control, the human erbB-2 gene was chosen as a model. A polydactyl protein specifically recognizing an 18-bp sequence in the 5′-untranslated region of this gene was converted into a transcriptional repressor by fusion with Krüppel-associated box (KRAB), ERD, or SID repressor domains. Transcriptional activators were generated by fusion with the herpes simplex VP16 activation domain or with a tetrameric repeat of VP16’s minimal activation domain, termed VP64. We demonstrate that both gene repression and activation can be achieved by targeting designed proteins to a single site within the transcribed region of a gene. We anticipate that gene-specific transcriptional regulators of the type described here will find diverse applications in gene therapy, functional genomics, and the generation of transgenic organisms.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Upstream A-tracts stimulate transcription from a variety of bacterial promoters, and this has been widely attributed to direct effects of the intrinsic curvature of A-tract-containing DNA. In this work we report experiments that suggest a different mechanism for the effects of upstream A-tracts on transcription. The similarity of A-tract-containing sequences to the adenine- and thymine-rich upstream recognition elements (UP elements) found in some bacterial promoters suggested that A-tracts might increase promoter activity by interacting with the α subunit of RNA polymerase (RNAP). We found that an A-tract-containing sequence placed upstream of the Escherichia coli lac or rrnB P1 promoters stimulated transcription both in vivo and in vitro, and that this stimulation required the C-terminal (DNA-binding) domain of the RNAP α subunit. The A-tract sequence was protected by wild-type RNAP but not by α-mutant RNAPs in footprints. The effect of the A-tracts on transcription was not as great as that of the most active UP elements, consistent with the degree of similarity of the A-tract sequence to the UP element consensus. A-tracts functioned best when positioned close to the −35 hexamer rather than one helical turn farther upstream, similar to the positioning optimal for UP element function. We conclude that A-tracts function as UP elements, stimulating transcription by providing binding site(s) for the RNAP αCTD, and we suggest that these interactions could contribute to the previously described wrapping of promoter DNA around RNAP.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A multiple protein–DNA complex formed at a human α-globin locus-specific regulatory element, HS-40, confers appropriate developmental expression pattern on human embryonic ζ-globin promoter activity in humans and transgenic mice. We show here that introduction of a 1-bp mutation in an NF-E2/AP1 sequence motif converts HS-40 into an erythroid-specific locus-control region. Cis-linkage with this locus-control region, in contrast to the wild-type HS-40, allows erythroid lineage-specific derepression of the silenced human ζ-globin promoter in fetal and adult transgenic mice. Furthermore, ζ-globin promoter activities in adult mice increase in proportion to the number of integrated DNA fragments even at 19 copies/genome. The mutant HS-40 in conjunction with human ζ-globin promoter thus can be used to direct position-independent and copy number-dependent expression of transgenes in adult erythroid cells. The data also supports a model in which competitive DNA binding of different members of the NF-E2/AP1 transcription factor family modulates the developmental stage specificity of an erythroid enhancer. Feasibility to reswitch on embryonic/fetal globin genes through the manipulation of nuclear factor binding at a single regulatory DNA motif is discussed.