97 resultados para Sequences (Liturgy)
Resumo:
B-lymphocyte-specific class switch recombination is known to occur between pairs of 2- to 10-kb switch regions located immediately upstream of the immunoglobulin constant heavy-chain genes. Others have shown that the recombination is temporally correlated with the induction of transcription at the targeted switch regions. To determine whether this temporal correlation is due to a mechanistic linkage, we have developed an extrachromosomal recombination assay that closely recapitulates DNA deletional class switch recombination. In this assay, the rate of recombination is measured between 24 and 48 hr posttransfection. We find that recombinants are generated in a switch sequence-dependent manner. Recombination occurs with a predominance within B-cell lines representative of the mature B-cell stage and within a subset of pre-B-cell lines. Transcription stimulates the switch sequence-dependent recombination. Importantly, transcription activates recombination only when directed in the physiologic orientation but has no effect when directed in the nonphysiologic orientation.
Resumo:
The suppressor of Hairy-wing [su(Hw)] protein exerts a polar effect on gene expression by repressing the function of transcriptional enhancers located distally from the promoter with respect to the location of su(Hw) binding sequences. The directionality of this effect suggests that the su(Hw) protein specifically interferes with the basic mechanism of enhancer action. Moreover, mutations in modifier of mdg4 [mod(mdg4)] result in the repression of expression of a gene when the su(Hw) protein is bound to sequences in the copy of this gene located in the homologous chromosome. This effect is dependent on the presence of the su(Hw) binding region from the gypsy retrotransposon in at least one of the chromosomes and is enhanced by the presence of additional gypsy sequences in the other homology. This phenomenon is inhibited by chromosomal rearrangements that disrupt pairing, suggesting that close apposition between the two copies of the affected gene is important for trans repression of transcription. These results indicate that, in the absence of mod-(mdg4) product, the su(Hw) protein present in one chromosome can act in trans and inactivate enhancers located in the other homolog.
Resumo:
To classify Listeria monocytogenes using taxonomic characters derived from the rRNA operons and their flanking sequences, we studied a sample of 1346 strains within the taxon. DNA from each strain was digested with a restriction endonuclease, EcoRI. The fragments were separated by gel electrophoresis, immobilized on a membrane, and hybridized with a labeled rRNA operon from Escherichia coli. The pattern of bands, positions, and intensities of hybridized fragments were electronically captured. Software was used to normalize the band positions relative to standards, scale the signal intensity, and reduce the background so that each strain was reproducibly represented in a data base as a pattern. With these methods, L. monocytogenes was resolved into 50 pattern types differing in the length of at least one polymorphic fragment. Pattern types representing multiple strains were recorded as the mathematical average of the strain patterns. Pattern types were arranged by size polymorphisms of assigned rRNA regions into subsets, which revealed the branching genetic structure of the species. Subtracting the polymorphic variants of a specific assigned region from the pattern types and averaging the types within each subset resulted in reduced sets of conserved fragments that could be used to recognize strains of the species. Pattern types and reduced sets of conserved fragments were conserved among different strains of L. monocytogenes but were not observed in total among strains of other species.
Resumo:
By using taxonomic characters derived from EcoRI restriction endonuclease digestion of genomic DNA and hybridization with a labeled rRNA operon from Escherichia coli, a polymorphic structure of Listeria monocytogenes, characterized by fragments with different frequencies of occurrence, was observed. This structure was expanded by creating predicted patterns through a recursive process of observation, expectation, prediction, and assessment of completeness. This process was applied, in turn, to normalized strain patterns, fragment bands, and positions of EcoRI recognition sites relative to rRNA regions. Analysis of 1346 strains provided observed patterns, fragment sizes, and their frequencies of occurrence in the patterns. Fragment size statistics led to the creation of unobserved combinations of bands, predicted pattern types. The observed fragment bands revealed positions of EcoRI sites relative to rRNA sequences. Each EcoRI site had a frequency of occurrence, and unobserved fragment sizes were postulated on the basis of knowing the restriction site locations. The result of the recursion process applied to the components of the strain data was an extended classification with observed and predicted members.
Resumo:
The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.
Resumo:
To study the binding specificity of Src homology 3 (SH3) domains, we have screened a mouse embryonic expression library for peptide fragments that interact with them. Several clones were identified that express fragments of proteins which, through proline-rich binding sites, exhibit differential binding specificity to various SH3 domains. Src-SH3-specific binding uses a sequence of 7 aa of the consensus RPLPXXP, in which the N-terminal arginine is very important. The SH3 domains of the Src-related kinases Fyn, Lyn, and Hck bind to this sequence with the same affinity as that of the Src SH3. In contrast, a quite different proline-rich sequence from the Btk protein kinase binds to the Fyn, Lyn, and Hck SH3 domains, but not to the Src SH3. Specific binding of the Abl SH3 requires a longer, more proline-rich sequence but no arginine. One clone that binds to both Src and Abl SH3 domains through a common site exhibits reversed binding orientation, in that an arginine indispensable for binding to all tested SH3 domains occurs at the C terminus. Another clone contains overlapping yet distinct Src and Abl SH3 binding sites. Binding to the SH3 domains is mediated by a common PXXP amino acid sequence motif present on all ligands, and specificity comes about from other interactions, often ones involving arginine. The rules governing in vivo usage of particular sites by particular SH3 domains are not clear, but one binding orientation may be more specific than another.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.