Unsaturation of the membrane lipids of chloroplasts stabilizes the photosynthetic machinery against low-temperature photoinhibition in transgenic tobacco plants.

Using tobacco plants that had been transformed with the cDNA for glycerol-3-phosphate acyltransferase, we have demonstrated that chilling tolerance is affected by the levels of unsaturated membrane lipids. In the present study, we examined the effects of the transformation of tobacco plants with cDNA for glycerol-3-phosphate acyltransferase from squash on the unsaturation of fatty acids in thylakoid membrane lipids and the response of photosynthesis to various temperatures. Of the four major lipid classes isolated from the thylakoid membranes, phosphatidylglycerol showed the most conspicuous decrease in the level of unsaturation in the transformed plants. The isolated thylakoid membranes from wild-type and transgenic plants did not significantly differ from each other in terms of the sensitivity of photosystem II to high and low temperatures and also to photoinhibition. However, leaves of the transformed plants were more sensitive to photoinhibition than those of wild-type plants. Moreover, the recovery of photosynthesis from photoinhibition in leaves of wild-type plants was faster than that in leaves of the transgenic tobacco plants. These results suggest that unsaturation of fatty acids of phosphatidylglycerol in thylakoid membranes stabilizes the photosynthetic machinery against low-temperature photoinhibition by accelerating the recovery of the photosystem II protein complex.

The DnaJ chaperone catalytically activates the DnaK chaperone to preferentially bind the sigma 32 heat shock transcriptional regulator.

In Escherichia coli the heat shock response is under the positive control of the sigma 32 transcription factor. Three of the heat shock proteins, DnaK, DnaI, and GrpE, play a central role in the negative autoregulation of this response at the transcriptional level. Recently, we have shown that the DnaK and DnaJ proteins can compete with RNA polymerase for binding to the sigma 32 transcription factor in the presence of ATP, by forming a stable DnaJ-sigma 32-DnaK protein complex. Here, we report that DnaJ protein can catalytically activate DnaK's ATPase activity. In addition, DnaJ can activate DnaK to bind to sigma 32 in an ATP-dependent reaction, forming a stable sigma 32-DnaK complex. Results obtained with two DnaJ mutants, a missense and a truncated version, suggest that the N-terminal portion of DnaJ, which is conserved in all family members, is essential for this activation reaction. The activated form of DnaK binds preferentially to sigma 32 versus the bacteriophage lambda P protein substrate.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Scar, a WASp-related protein, activates nucleation of actin filaments by the Arp2/3 complex

The Arp2/3 complex, a stable assembly of two actin-related proteins (Arp2 and Arp3) with five other subunits, caps the pointed end of actin filaments and nucleates actin polymerization with low efficiency. WASp and Scar are two similar proteins that bind the p21 subunit of the Arp2/3 complex, but their effect on the nucleation activity of the complex was not known. We report that full-length, recombinant human Scar protein, as well as N-terminally truncated Scar proteins, enhance nucleation by the Arp2/3 complex. By themselves, these proteins either have no effect or inhibit actin polymerization. The actin monomer-binding W domain and the p21-binding A domain from the C terminus of Scar are both required to activate Arp2/3 complex. A proline-rich domain in the middle of Scar enhances the activity of the W and A domains. Preincubating Scar and Arp2/3 complex with actin filaments overcomes the initial lag in polymerization, suggesting that efficient nucleation by the Arp2/3 complex requires assembly on the side of a preexisting filament—a dendritic nucleation mechanism. The Arp2/3 complex with full-length Scar, Scar containing P, W, and A domains, or Scar containing W and A domains overcomes inhibition of nucleation by the actin monomer-binding protein profilin, giving active nucleation over a low background of spontaneous nucleation. These results show that Scar and, likely, related proteins, such as the Cdc42 targets WASp and N-WASp, are endogenous activators of actin polymerization by the Arp2/3 complex.

Human CUL1 forms an evolutionarily conserved ubiquitin ligase complex (SCF) with SKP1 and an F-box protein

The SCF ubiquitin ligase complex of budding yeast triggers DNA replication by catalyzing ubiquitination of the S phase cyclin-dependent kinase inhibitor SIC1. SCF is composed of three proteins—ySKP1, CDC53 (Cullin), and the F-box protein CDC4—that are conserved from yeast to humans. As part of an effort to identify components and substrates of a putative human SCF complex, we isolated hSKP1 in a two-hybrid screen with hCUL1, the closest human homologue of CDC53. Here, we show that hCUL1 associates with hSKP1 in vivo and directly interacts with both hSKP1 and the human F-box protein SKP2 in vitro, forming an SCF-like particle. Moreover, hCUL1 complements the growth defect of yeast cdc53ts mutants, associates with ubiquitination-promoting activity in human cell extracts, and can assemble into functional, chimeric ubiquitin ligase complexes with yeast SCF components. Taken together, these data suggest that hCUL1 functions as part of an SCF ubiquitin ligase complex in human cells. Further application of biochemical assays similar to those described here can now be used to identify regulators/components of hCUL1-based SCF complexes, to determine whether the hCUL2–hCUL5 proteins also are components of ubiquitin ligase complexes in human cells, and to screen for chemical compounds that modulate the activities of the hSKP1 and hCUL1 proteins.

Identification of the von Hippel–Lindau tumor-suppressor protein as part of an active E3 ubiquitin ligase complex

Mutations of von Hippel–Lindau disease (VHL) tumor-suppressor gene product (pVHL) are found in patients with dominant inherited VHL syndrome and in the vast majority of sporadic clear cell renal carcinomas. The function of the pVHL protein has not been clarified. pVHL has been shown to form a complex with elongin B and elongin C (VBC) and with cullin (CUL)-2. In light of the structural analogy of VBC-CUL-2 to SKP1-CUL-1-F-box ubiquitin ligases, the ubiquitin ligase activity of VBC-CUL-2 was examined in this study. We show that VBC-CUL-2 exhibits ubiquitin ligase activity, and we identified UbcH5a, b, and c, but not CDC34, as the ubiquitin-conjugating enzymes of the VBC-CUL-2 ubiquitin ligase. The protein Rbx1/ROC1 enhances ligase activity of VBC-CUL-2 as it does in the SKP1-CUL-1-F-box protein ligase complex. We also found that pVHL associates with two proteins, p100 and p220, which migrate at a similar molecular weight as two major bands in the ubiquitination assay. Furthermore, naturally occurring pVHL missense mutations, including mutants capable of forming a complex with elongin B–elongin C-CUL-2, fail to associate with p100 and p220 and cannot exhibit the E3 ligase activity. These results suggest that pVHL might be the substrate recognition subunit of the VBC-CUL-2 E3 ligase. This is also, to our knowledge, the first example of a human tumor-suppressor protein being directly involved in the ubiquitin conjugation system which leads to the targeted degradation of substrate proteins.

Peropsin, a novel visual pigment-like protein located in the apical microvilli of the retinal pigment epithelium

A visual pigment-like protein, referred to as peropsin, has been identified by large-scale sequencing of cDNAs derived from human ocular tissues. The corresponding mRNA was found only in the eye, where it is localized to the retinal pigment epithelium (RPE). Peropsin immunoreactivity, visualized by light and electron microscopy, localizes the protein to the apical face of the RPE, and most prominently to the microvilli that surround the photoreceptor outer segments. These observations suggest that peropsin may play a role in RPE physiology either by detecting light directly or by monitoring the concentration of retinoids or other photoreceptor-derived compounds.

Targeting HIV proteins to the major histocompatibility complex class I processing pathway with a novel gp120-anthrax toxin fusion protein

A challenge for subunit vaccines whose goal is to elicit CD8+ cytotoxic T lymphocytes (CTLs) is to deliver the antigen to the cytosol of the living cell, where it can be processed for presentation by major histocompatibility complex (MHC) class I molecules. Several bacterial toxins have evolved to efficiently deliver catalytic protein moieties to the cytosol of eukaryotic cells. Anthrax lethal toxin consists of two distinct proteins that combine to form the active toxin. Protective antigen (PA) binds to cells and is instrumental in delivering lethal factor (LF) to the cell cytosol. To test whether the lethal factor protein could be exploited for delivery of exogenous proteins to the MHC class I processing pathway, we constructed a genetic fusion between the amino-terminal 254 aa of LF and the gp120 portion of the HIV-1 envelope protein. Cells treated with this fusion protein (LF254-gp120) in the presence of PA effectively processed gp120 and presented an epitope recognized by HIV-1 gp120 V3-specific CTL. In contrast, when cells were treated with the LF254-gp120 fusion protein and a mutant PA protein defective for translocation, the cells were not able to present the epitope and were not lysed by the specific CTL. The entry into the cytosol and dependence on the classical cytosolic MHC class I pathway were confirmed by showing that antigen presentation by PA + LF254-gp120 was blocked by the proteasome inhibitor lactacystin. These data demonstrate the ability of the LF amino-terminal fragment to deliver antigens to the MHC class I pathway and provide the basis for the development of novel T cell vaccines.

Recruitment of IRAK to the interleukin 1 receptor complex requires interleukin 1 receptor accessory protein

The proinflammatory cytokine interleukin 1 (IL-1) activates the transcription of many genes encoding acute phase and proinflammatory proteins, a function mediated primarily by the transcription factor NF-κB. An early IL-1 signaling event is the recruitment of the Ser/Thr kinase IRAK to the type I IL-1 receptor (IL-1RI). Here we describe the function of a previously identified IL-1 receptor subunit designated IL-1 receptor accessory protein (IL-1RAcP). IL-1 treatment of cells induces the formation of a complex containing both IL-1RI and IL-1RAcP. IRAK is recruited to this complex through its association with IL-1RAcP. Overexpression of an IL-1RAcP mutant lacking its intracellular domain, the IRAK-binding domain, prevented the recruitment of IRAK to the receptor complex and blocked IL-1-induced NF-κB activation.

Retina-specific nuclear receptor: A potential regulator of cellular retinaldehyde-binding protein expressed in retinal pigment epithelium and Müller glial cells

In an effort to identify nuclear receptors important in retinal disease, we screened a retina cDNA library for nuclear receptors. Here we describe the identification of a retina-specific nuclear receptor (RNR) from both human and mouse. Human RNR is a splice variant of the recently published photoreceptor cell-specific nuclear receptor [Kobayashi, M., Takezawa, S., Hara, K., Yu, R. T., Umesono, Y., Agata, K., Taniwaki, M., Yasuda, K. & Umesono, K. (1999) Proc. Natl. Acad. Sci. USA 96, 4814–4819] whereas the mouse RNR is a mouse ortholog. Northern blot and reverse transcription–PCR analyses of human mRNA samples demonstrate that RNR is expressed exclusively in the retina, with transcripts of ≈7.5 kb, ≈3.0 kb, and ≈2.3 kb by Northern blot analysis. In situ hybridization with multiple probes on both primate and mouse eye sections demonstrates that RNR is expressed in the retinal pigment epithelium and in Müller glial cells. By using the Gal4 chimeric receptor/reporter cotransfection system, the ligand binding domain of RNR was found to repress transcriptional activity in the absence of exogenous ligand. Gel mobility shift assays revealed that RNR can interact with the promoter of the cellular retinaldehyde binding protein gene in the presence of retinoic acid receptor (RAR) and/or retinoid X receptor (RXR). These data raise the possibility that RNR acts to regulate the visual cycle through its interaction with cellular retinaldehyde binding protein and therefore may be a target for retinal diseases such as retinitis pigmentosa and age-related macular degeneration.

A multimeric complex and the nuclear targeting of the Drosophila Rel protein Dorsal

The intracellular part of the Rel signal transduction pathway in Drosophila is encoded by Toll, tube, pelle, dorsal, and cactus, and it functions to form the dorsal–ventral axis in the Drosophila embryo. Upon activation of the transmembrane receptor Toll, Dorsal dissociates from its cytoplasmic inhibitor Cactus and enters the nucleus. Tube and Pelle are required to relay the signal from Toll to the Dorsal–Cactus complex. In a yeast two-hybrid assay, we found that both Tube and Pelle interact with Dorsal. We confirmed these interactions in an in vitro binding assay. Tube interacts with Dorsal via its C-terminal domain, whereas full-length Pelle is required for Dorsal binding. Tube and Pelle bind Dorsal in the N-terminal domain 1 of the Dorsal Rel homology region rather than at the Cactus binding site. Domain 1 has been found to be necessary for Dorsal nuclear targeting. Genetic experiments indicate that Tube–Dorsal interaction is necessary for normal signal transduction. We propose a model in which Tube, Pelle, Cactus, and Dorsal form a multimeric complex that represents an essential aspect of signal transduction.

The Integral Membrane Protein Snl1p Is Genetically Linked to Yeast Nuclear Pore Complex Function

Integral membrane proteins are predicted to play key roles in the biogenesis and function of nuclear pore complexes (NPCs). Revealing how the transport apparatus is assembled will be critical for understanding the mechanism of nucleocytoplasmic transport. We observed that expression of the carboxyl-terminal 200 amino acids of the nucleoporin Nup116p had no effect on wild-type yeast cells, but it rendered the nup116 null strain inviable at all temperatures and coincidentally resulted in the formation of nuclear membrane herniations at 23°C. To identify factors related to NPC function, a genetic screen for high-copy suppressors of this lethal nup116-C phenotype was conducted. One gene (designated SNL1 for suppressor of nup116-C lethal) was identified whose expression was necessary and sufficient for rescuing growth. Snl1p has a predicted molecular mass of 18.3 kDa, a putative transmembrane domain, and limited sequence similarity to Pom152p, the only previously identified yeast NPC-associated integral membrane protein. By both indirect immunofluorescence microscopy and subcellular fractionation studies, Snl1p was localized to both the nuclear envelope and the endoplasmic reticulum. Membrane extraction and topology assays suggested that Snl1p was an integral membrane protein, with its carboxyl-terminal region exposed to the cytosol. With regard to genetic specificity, the nup116-C lethality was also suppressed by high-copy GLE2 and NIC96. Moreover, high-copy SNL1 suppressed the temperature sensitivity of gle2–1 and nic96-G3 mutant cells. The nic96-G3 allele was identified in a synthetic lethal genetic screen with a null allele of the closely related nucleoporin nup100. Gle2p physically associated with Nup116p in vitro, and the interaction required the N-terminal region of Nup116p. Therefore, genetic links between the role of Snl1p and at least three NPC-associated proteins were established. We suggest that Snl1p plays a stabilizing role in NPC structure and function.

Nascent Polypeptide–associated Complex Stimulates Protein Import into Yeast Mitochondria

To identify yeast cytosolic proteins that mediate targeting of precursor proteins to mitochondria, we developed an in vitro import system consisting of purified yeast mitochondria and a radiolabeled mitochondrial precursor protein whose C terminus was still attached to the ribosome. In this system, the N terminus of the nascent chain was translocated across both mitochondrial membranes, generating a translocation intermediate spanning both membranes. The nascent chain could then be completely chased into the mitochondrial matrix after release from the ribosome. Generation of this import intermediate was dependent on a mitochondrial membrane potential, mitochondrial surface proteins, and was stimulated by proteins that could be released from the ribosomes by high salt. The major salt-released stimulatory factor was yeast nascent polypeptide–associated complex (NAC). Purified NAC fully restored import of salt-washed ribosome-bound nascent chains by enhancing productive binding of the chains to mitochondria. We propose that ribosome-associated NAC facilitates recognition of nascent precursor chains by the mitochondrial import machinery.

LC2, the Chlamydomonas Homologue of the t Complex-encoded Protein Tctex2, Is Essential for Outer Dynein Arm Assembly

Tctex2 is thought to be one of the distorter genes of the mouse t haplotype. This complex greatly biases the segregation of the chromosome that carries it such that in heterozygous +/t males, the t haplotype is transmitted to >95% of the offspring, a phenomenon known as transmission ratio distortion. The LC2 outer dynein arm light chain of Chlamydomonas reinhardtii is a homologue of the mouse protein Tctex2. We have identified Chlamydomonas insertional mutants with deletions in the gene encoding LC2 and demonstrate that the LC2 gene is the same as the ODA12 gene, the product of which had not been identified previously. Complete deletion of the LC2/ODA12 gene causes loss of all outer arms and a slow jerky swimming phenotype. Transformation of the deletion mutant with the cloned LC2/ODA12 gene restores the outer arms and rescues the motility phenotype. Therefore, LC2 is required for outer arm assembly. The fact that LC2 is an essential subunit of flagellar outer dynein arms allows us to propose a detailed mechanism whereby transmission ratio distortion is explained by the differential binding of mutant (t haplotype encoded) and wild-type dyneins to the axonemal microtubules of t-bearing or wild-type sperm, with resulting differences in their motility.

The Saccharomyces cerevisiae Homologue of Human Wiskott–Aldrich Syndrome Protein Las17p Interacts with the Arp2/3 Complex

Yeast Las17 protein is homologous to the Wiskott–Aldrich Syndrome protein, which is implicated in severe immunodeficiency. Las17p/Bee1p has been shown to be important for actin patch assembly and actin polymerization. Here we show that Las17p interacts with the Arp2/3 complex. LAS17 is an allele-specific multicopy suppressor of ARP2 and ARP3 mutations; overexpression restores both actin patch organization and endocytosis defects in ARP2 temperature-sensitive (ts) cells. Six of seven ARP2 ts mutants and at least one ARP3 ts mutant are synthetically lethal with las17Δ ts confirming functional interaction with the Arp2/3 complex. Further characterization of las17Δ cells showed that receptor-mediated internalization of α factor by the Ste2 receptor is severely defective. The polarity of normal bipolar bud site selection is lost. Las17-gfp remains localized in cortical patches in vivo independently of polymerized actin and is required for the polarized localization of Arp2/3 as well as actin. Coimmunoprecipitation of Arp2p with Las17p indicates that Las17p interacts directly with the complex. Two hybrid results also suggest that Las17p interacts with actin, verprolin, Rvs167p and several other proteins including Src homology 3 (SH3) domain proteins, suggesting that Las17p may integrate signals from different regulatory cascades destined for the Arp2/3p complex and the actin cytoskeleton.